Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-320d precursor (ppy-mir-320d-2)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-320d precursor (ppy-mir-320d-2) URS000075DEE6_9600

48 nucleotides
2 databases (miRBase, Rfam)
Found in 5 other species
1869 publications
1. transcript
2. pre-miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

UUCUCUUCCCAGUUCUUCUUGGAGUCAGGAAAAGCUGGGUUGAGAGGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 5 other species

Homo sapiens microRNA 320d-2 (ENSG00000221081.1)
Nomascus leucogenys (Northern white-cheeked gibbon) microRNA 320d-2 (ENSNLEG00000028119.1)
Pan paniscus (bonobo) microRNA 320d-2 (ENSPPAG00000016611.1)
Pan troglodytes ptr-mir-320d-3 (ENSPTRG00000034749.2)
Pongo abelii miRNA

2D structure

Publications