Gorilla gorilla gorilla (Western Lowland Gorilla) microRNA 758 (ENSGGOG00000032587.2)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gorilla gorilla gorilla (Western Lowland Gorilla) microRNA 758 (ENSGGOG00000032587.2) URS000075DEC1_9595

88 nucleotides
1 database (Ensembl)
Found in 11 other species
11 publications

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

GCCUGGAUACAUGAGAUGGUUGACCAGAGAGCACACGCUUUAUUUGUGCCGUUUGUGACCUGGUCCACUAACCCUCAGUAUCUAAUGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 11 other species

Aotus nancymaae (Ma's night monkey) microRNA 758 (ENSANAG00000001287.1)
Callithrix jacchus (white-tufted-ear marmoset) microRNA 758 (ENSCJAG00000028891.3)
Homo sapiens microRNA hsa-mir-758 precursor
Nomascus leucogenys (Northern white-cheeked gibbon) microRNA 758 (ENSNLEG00000022450.2)
Pan paniscus (bonobo) microRNA 758 (ENSPPAG00000005350.1)
Pan troglodytes ptr-mir-758 (ENSPTRG00000032237.2)
Pongo abelii microRNA 758 (ENSPPYG00000021720.2)
Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-758 precursor
Saimiri boliviensis boliviensis (Bolivian squirrel monkey) microRNA 758 (ENSSBOG00000009759.1)

Publications