v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Bison bison bison (American bison) microRNA 330 (ENSBBBG00000000818.1) secondary structure diagram

Bison bison bison (American bison) microRNA 330 (ENSBBBG00000000818.1) URS000075DEAB_43346

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CUUCGGCGAUCACUGCCUCUCUGGGCCUGUGUCUUAGGCUCUGCAAGAUCAACCGAGCAAAGCACACGGCCUGCAGAGAGGCAGCGCUCAGCUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

  1. Bos grunniens microRNA 330 (ENSBGRG00000021743.1)
  2. Bos indicus x Bos taurus miRNA (ENSBIXG00000002918.1, ENSBIXG00005022584.1)
  3. Bos taurus microRNA bta-mir-330 precursor
 2D structure Publications