Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Xenopus laevis (African clawed frog) xla-miR-192-5p URS000075DE87_8355

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUGACCUAUGAAUUGACAGCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 16 other species

  1. Chrysemys picta bellii (western painted turtle) Cpi-Mir-192-P2_5p (mature (guide))
  2. Chrysemys picta cpi-miR-192-5p
  3. Cyprinus carpio (common carp) ccr-miR-192
  4. Danio rerio dre-miR-192
  5. Gekko japonicus Gja-Mir-192-P2_5p (mature (guide))
  6. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-192
  7. Ictalurus punctatus (channel catfish) ipu-miR-192
  8. Maylandia zebra (zebra mbuna) mze-miR-192
  9. Neolamprologus brichardi (lyretail cichlid) nbr-miR-192
  10. Oreochromis niloticus (Nile tilapia) oni-miR-192
  11. Pundamilia nyererei pny-miR-192
  12. Salmo salar ssa-miR-192a-5p
  13. Takifugu rubripes fru-miR-192
  14. Tetraodon nigroviridis tni-miR-192
  15. Tor tambroides miR-192
  16. Xenopus tropicalis xtr-miR-192