Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Danio rerio (zebrafish) dre-miR-192 URS000075DE87_7955

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Danio rerio. Annotated by 3 databases (ENA, miRBase, RefSeq). Danio rerio (zebrafish) dre-miR-192 sequence is a product of dre-miR-192, miR-192, mir192 genes. Found in the zebrafish reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    AUGACCUAUGAAUUGACAGCC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 16 other species

    1. Chrysemys picta bellii Cpi-Mir-192-P2_5p (mature (guide))
    2. Chrysemys picta (Painted turtle) cpi-miR-192-5p
    3. Cyprinus carpio ccr-miR-192
    4. Gekko japonicus Gja-Mir-192-P2_5p (mature (guide))
    5. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-192
    6. Ictalurus punctatus (channel catfish) ipu-miR-192
    7. Maylandia zebra (zebra mbuna) mze-miR-192
    8. Neolamprologus brichardi nbr-miR-192
    9. Oreochromis niloticus oni-miR-192
    10. Pundamilia nyererei pny-miR-192
    11. Salmo salar (Atlantic salmon) ssa-miR-192a-5p
    12. Takifugu rubripes (torafugu) fru-miR-192
    13. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-192
    14. Tor tambroides (Thai mahseer) miR-192
    15. Xenopus laevis xla-miR-192-5p
    16. Xenopus tropicalis xtr-miR-192
    Publications New