Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Danio rerio (zebrafish) dre-miR-192 URS000075DE87_7955

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Danio rerio. Annotated by 3 databases (RefSeq, ENA, miRBase). Described in 11 papers. Danio rerio (zebrafish) dre-miR-192 sequence is a product of dre-miR-192, mir192, miR-192 genes. Found in the zebrafish reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    AUGACCUAUGAAUUGACAGCC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 29 other species

    1. Chrysemys picta bellii Cpi-Mir-192-P1_5p (mature (guide))
    2. Chrysemys picta cpi-miR-192-5p
    3. Cyprinus carpio (common carp) ccr-miR-192
    4. Haplochromis burtoni abu-miR-192
    5. Ictalurus punctatus (channel catfish) ipu-miR-192
    6. Maylandia zebra (zebra mbuna) mze-miR-192
    7. Neolamprologus brichardi nbr-miR-192
    8. Oreochromis niloticus (Nile tilapia) oni-miR-192
    9. Pundamilia nyererei pny-miR-192
    10. Salmo salar ssa-miR-192a-5p
    11. Takifugu rubripes fru-miR-192
    12. Tetraodon nigroviridis tni-miR-192
    13. Tor tambroides miR-192
    14. Xenopus laevis (African clawed frog) xla-miR-192-5p
    15. Xenopus tropicalis (tropical clawed frog) xtr-miR-192