Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Rattus norvegicus (Norway rat) microRNA rno-mir-499 precursor URS000075DE6B_10116

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

rno-mir-499: Rno-mir-499 is a microRNA that is down-regulated in the heart of injured animals, as observed in the data [PMC6377737]. Interestingly, it is up-regulated in the lung of injured animals, along with rno-miR-208a and rno-mir-499-5p [PMC6377737]. In a study comparing heart failure (HF) and control groups, rno-miR-1-3p, rno-let-7 family, rno-miR-29a-3p, rno-miR-133a-3p, rno-mir-499-5p and rno-miR-140 were found to be highly expressed in both groups [PMC4978447]. This finding is consistent with previous studies that have shown high expression of rno-miR133a, rno-miR1 and rno-mir499 in the heart [PMC4978447]. In another study on kidney stone formation, it was found that the expression of rno-miR192, rnomiR194 and rn0mir499 was higher in the stone-forming group compared to their potential target gene chemokine receptor 2 (CCR2) [PMC5748115]. This suggests that overexpression of CCR2 mediated by these miRNAs could induce inflammation and damage to renal tubular epithelial cells and promote nephrolithiasis [PMC5748115]. The synthesis of complementary DNA was performed using High-Capacity cDNA reverse transcription kits according to the manufacturer's instructions with respective primers for rn0mir499 [PMC3515561]. The primers used for rn0mir499 were: sense: 5′GGGGTTAAGACTTGCAGTG′3′ and antisense: 5′CAGTGCGTGTCGTGGAGT′3′ [PMC3515561].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCUGUUAAGACUUGCAGUGAUGUUUAGCUCCUCUCCAUGUGAACAUCACAGCAAGUCUGUGCUGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Meriones unguiculatus miRNA (ENSMUGG00000007860.1)
Publications