Automated summary: This pre miRNA sequence is 90 nucleotides long and is found in Danio rerio. Annotated by 5 databases (miRBase, Rfam, ENA, Ensembl, RefSeq). Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-731, RF03622). Danio rerio (zebrafish) microRNA dre-mir-731 precursor sequence is a product of mir-731 precursor, ENSDARG00000080568.2, mir-731 precurso, 731 microRNA precursor family, 731 microRNA precursor famil, mir731, dre-mir-731 precursor, mir-731, mir-731 microRNA precursor family genes. Found in the zebrafish reference genome.
This sequence is found in {{ locations.length }} genome
| Go to location | Chromosome | Start | End | Strand | Ensembl | UCSC | Sequence identity | |
|---|---|---|---|---|---|---|---|---|
| Loading genome locations... | ||||||||
| Failed to load data from server | ||||||||
| No genome locations known | ||||||||
|
loading browser
|
{{ location.chromosome }} | {{ location.start | number }} | {{ location.end | number }} | {{ location.strand == "1" ? "forward" : "reverse" }} | {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} | UCSC | 100% | {{ location.identity * 100 | number:0 }}% |
No genome locations found for this sequence. Learn more →
Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset
UGAUGCUGAUCUGGAAUGACACGUUUUCUCCCGGAUCGCCAGAAAUAUGUUUCGCCACCGGGAACUUCGUGUCAGCCAAGAUUGGCAUCA
View annotations in different species by clicking on species names.
Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.