v22

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus let-7e stem-loop (bta-let-7e) URS000075DE48_9913

Automated summary: This pre miRNA sequence is 79 nucleotides long and is found in Bos taurus. Annotated by 3 databases (ENA, RefSeq, miRBase). Matches 1 Rfam family (let-7, RF00027). Bos taurus let-7e stem-loop (bta-let-7e) sequence is a product of 7e, bta-let-7e precursor, 7, MIRLET7E, let-7e precursor, let-7e, let-7e precurso genes. Found in the Bos taurus reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
    		•  {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences 
    CCCGGGCUGAGGUAGGAGGUUGUAUAGUUGAGGAGGACACCCAAGGAGAUCACUAUACGGCCUCCUAGCUUUCCCCAGG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 22 other species

    1. Capra hircus microRNA let-7e (ENSCHIG00000002081.1)
    2. Carlito syrichta miRNA (ENSTSYG00000031768.1)
    3. Cercocebus atys (Sooty mangabey) miRNA (ENSCATG00000017617.1)
    4. Chlorocebus sabaeus (African green monkey) miRNA (ENSCSAG00000022868.1)
    5. Colobus angolensis palliatus (Angola colobus) miRNA (ENSCANG00000004539.1)
    6. Gorilla gorilla gorilla microRNA let-7e (ENSGGOG00000029478.2)
    7. Homo sapiens let-7e stem-loop (hsa-let-7e)
    8. Loxodonta africana microRNA let-7e (ENSLAFG00000027405.1)
    9. Macaca fascicularis (Crab-eating macaque) miRNA
    10. Macaca mulatta let-7e stem-loop (mml-let-7e)
    11. Macaca nemestrina miRNA (ENSMNEG00000024859.1)
    12. Mandrillus leucophaeus (Drill) miRNA (ENSMLEG00000009968.1)
    13. Microcebus murinus (gray mouse lemur) miRNA MIRLET7E (ENSMICG00000034098.2)
    14. Otolemur garnettii miRNA (ENSOGAG00000031430.1)
    15. Pan paniscus miRNA MIRLET7E (ENSPPAG00000015689.1)
    16. Pan troglodytes ptr-let-7e (ENSPTRG00000027715.3)
    17. Papio anubis miRNA (ENSPANG00000001011.2)
    18. Pongo abelii (Sumatran orangutan) miRNA
    19. Pongo pygmaeus let-7e stem-loop (ppy-let-7e)
    20. Procavia capensis (cape rock hyrax) miRNA (ENSPCAG00000020099.1)
    21. Prolemur simus (greater bamboo lemur) miRNA (ENSPSMG00000026067.1)
    22. Propithecus coquereli (Coquerel's sifaka) miRNA (ENSPCOG00000002270.1)
    23. Rhinopithecus bieti miRNA (ENSRBIG00000010485.1)
    24. Rhinopithecus roxellana miRNA (ENSRROG00000005998.1)
     Publications