Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Mus musculus (house mouse) microRNA mmu-mir-22 precursor secondary structure diagram

Mus musculus (house mouse) microRNA mmu-mir-22 precursor URS000075DE23_10090

Automated summary: This pre miRNA sequence is 95 nucleotides long and is found in Mus musculus. Annotated by 6 databases (Ensembl, RefSeq, miRBase, MGI, Ensembl/GENCODE, ENA). Described in 40 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-22, RF00653). Mus musculus (house mouse) microRNA mmu-mir-22 precursor sequence is a product of mir-22, Mir22, mmu-mir-22 precursor, mir-22 precurso, mir-22 precursor genes.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    ACCUGGCUGAGCCGCAGUAGUUCUUCAGUGGCAAGCUUUAUGUCCUGACCCAGCUAAAGCUGCCAGUUGAAGAACUGUUGCCCUCUGCCCCUGGC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 22 other species

    1. Ailuropoda melanoleuca microRNA 22
    2. Artibeus jamaicensis microRNA aja-mir-22 precursor
    3. Cavia porcellus microRNA 22
    4. Chinchilla lanigera (Long-tailed chinchilla) microRNA 22
    5. Cricetulus griseus (Chinese hamster) microRNA 22
    6. Dipodomys ordii miRNA
    7. Erinaceus europaeus (western European hedgehog) microRNA 22
    8. Fukomys damarensis (Damara mole rat) miRNA
    9. Ictidomys tridecemlineatus microRNA 22
    10. Loxodonta africana microRNA 22
    11. Microtus ochrogaster microRNA 22
    12. Mus caroli microRNA 22
    13. Mus pahari microRNA 22
    14. Mus spretus microRNA 22
    15. Nannospalax galili miRNA
    16. Ochotona princeps miRNA
    17. Octodon degus (Degu) miRNA
    18. Ovis aries miRNA
    19. Pongo abelii microRNA 22
    20. Pteropus vampyrus microRNA 22
    21. Sorex araneus microRNA 22
    22. Tupaia belangeri microRNA 22
    23. Tursiops truncatus (bottlenosed dolphin) microRNA 22
    24. Vicugna pacos (alpaca) microRNA 22
    2D structure New