Automated summary: This pre miRNA sequence is 78 nucleotides long and is found in Mus musculus. Annotated by 6 databases (Ensembl, ENA, RefSeq, miRBase, Rfam, MGI). Mus musculus (house mouse) microRNA mmu-mir-3473a precursor sequence is a product of mir-3473a precursor, mir-3473 microRNA precursor family, ENSMUSG00000092752.3, mmu-mir-3473a precursor, 3473 microRNA precursor family, mir-3473a, mir-3473a precurso, 3473 microRNA precursor famil, Mir3473a genes. Found in the Mus musculus reference genome.
This sequence is found in {{ locations.length }} genome
| Go to location | Chromosome | Start | End | Strand | Ensembl | UCSC | Sequence identity | |
|---|---|---|---|---|---|---|---|---|
| Loading genome locations... | ||||||||
| Failed to load data from server | ||||||||
| No genome locations known | ||||||||
|
loading browser
|
{{ location.chromosome }} | {{ location.start | number }} | {{ location.end | number }} | {{ location.strand == "1" ? "forward" : "reverse" }} | {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} | UCSC | 100% | {{ location.identity * 100 | number:0 }}% |
No genome locations found for this sequence. Learn more →
Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset
CCUGUUGAGCCAUCUCACCAGCCCAGAAAAUAUUUUUAAAAAGUGAAUUGUCUUAAGCUGGAGAGAUGGCUCAGCAGU
View annotations in different species by clicking on species names.
Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.