Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-1206 URS000075DD83_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-1206: Hsa-mir-1206 is a microRNA that has been predicted as a target in various studies [PMC8100644] [PMC6948356] [PMC3140991] [PMC4822037] [PMC4883781] [PMC7890329]. It has been found to be closely related to different types of tumor development [PMC6948356]. In one study, hsa-mir-1206 was examined along with other miRNAs embedded within the PVT1 locus, but its expression was found to be very low or undetectable in both normal and tumor prostate samples [PMC3140991]. TaqMan miRNA expression assays were used to study the expression of hsa-mir-1206 and other target miRNAs from the PVT1 gene, along with endogenous controls, in a study conducted by Applied Biosystems [PMC3140991]. In another study, hsa-mir-1206 was predicted as a potential target of circ_SMAD2 using Circbank and circInteractome analysis [PMC7890329]. The function of hsa-mir-1206 on putative target proteins was verified by inhibiting its expression and examining the resulting modulations in protein targets in another study using SH-SY5Y cells and Operetta high content quantitative confocal imaging [PMC4951313]. Overall, hsa-mir-1206 has been identified as a potential target in various studies related to tumor development and protein modulation.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGUUCAUGUAGAUGUUUAAGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Pan troglodytes ptr-miR-1206
Publications