Panthera pardus (leopard) microRNA 148a (ENSPPRG00000014031.1)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Panthera pardus (leopard) microRNA 148a (ENSPPRG00000014031.1) URS000075DD6C_9691

68 nucleotides
1 database (Ensembl)
Found in 10 other species
192 publications
1. transcript
2. pre-miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

GAGGCAAAGUUCUGAGACACUCCGACUCUGAAUAUGAUAGAAGUCAGUGCACUACAGAACUUUGUCUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 10 other species

Bos taurus microRNA bta-mir-148a precursor
Capra hircus microRNA mir-148a (ENSCHIG00000009488.1)
Equus caballus microRNA eca-mir-148a precursor
Mustela putorius furo (Domestic ferret) miRNA (ENSMPUG00000021448.1)
Ovis aries microRNA oar-mir-148a precursor
Panthera tigris altaica miRNA (ENSPTIG00000002556.1)
Pteropus vampyrus (large flying fox) miRNA (ENSPVAG00000025041.1)
Sus scrofa (pig) microRNA ssc-mir-148a precursor
Tursiops truncatus (bottlenosed dolphin) miRNA (ENSTTRG00000024176.1)
Vicugna pacos (alpaca) miRNA (ENSVPAG00000015792.1)

2D structure

Publications