Automated summary: This pre miRNA sequence is 68 nucleotides long and is found in Bos taurus. Annotated by 4 databases (ENA, RefSeq, miRBase, Rfam). Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-148, RF00248). Bos taurus (cattle) microRNA bta-mir-148a precursor sequence is a product of bta-mir-148a precursor, mir-148a precurso, MIR148A, mir-148/mir-152 microRNA precursor family, mir-148a, 148/mir-152 microRNA precursor family, 148/mir-152 microRNA precursor famil, 148a, mir-148a precursor, 148 genes. Found in the Bos taurus reference genome.
This sequence is found in {{ locations.length }} genome
| Go to location | Chromosome | Start | End | Strand | Ensembl | UCSC | Sequence identity | |
|---|---|---|---|---|---|---|---|---|
| Loading genome locations... | ||||||||
| Failed to load data from server | ||||||||
| No genome locations known | ||||||||
|
loading browser
|
{{ location.chromosome }} | {{ location.start | number }} | {{ location.end | number }} | {{ location.strand == "1" ? "forward" : "reverse" }} | {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} | UCSC | 100% | {{ location.identity * 100 | number:0 }}% |
No genome locations found for this sequence. Learn more →
Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset
GAGGCAAAGUUCUGAGACACUCCGACUCUGAAUAUGAUAGAAGUCAGUGCACUACAGAACUUUGUCUC
View annotations in different species by clicking on species names.
Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.