Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Bos taurus (cattle) microRNA bta-mir-148a precursor secondary structure diagram

Bos taurus (cattle) microRNA bta-mir-148a precursor URS000075DD6C_9913

Automated summary: This pre miRNA sequence is 68 nucleotides long and is found in Bos taurus. Annotated by 3 databases (RefSeq, miRBase, ENA). Described in 6 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-148, RF00248). Bos taurus (cattle) microRNA bta-mir-148a precursor sequence is a product of 148, mir-148a precursor, bta-mir-148a precursor, mir-148a, MIR148A, 148a, mir-148a precurso genes. Found in the cattle reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    GAGGCAAAGUUCUGAGACACUCCGACUCUGAAUAUGAUAGAAGUCAGUGCACUACAGAACUUUGUCUC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 9 other species

    1. Ailuropoda melanoleuca miRNA
    2. Capra hircus (Goat) microRNA mir-148a (MIR148A)
    3. Equus caballus (horse) microRNA eca-mir-148a precursor
    4. Mustela putorius furo (Domestic ferret) miRNA
    5. Ovis aries microRNA oar-mir-148a precursor
    6. Panthera pardus microRNA 148a
    7. Panthera tigris altaica (Tiger) miRNA
    8. Pteropus vampyrus miRNA
    9. Sus scrofa (pig) microRNA ssc-mir-148a precursor
    10. Tursiops truncatus (bottlenosed dolphin) miRNA
    11. Vicugna pacos (alpaca) miRNA
    2D structure New