Automated summary: This pre miRNA sequence is 265 nucleotides long and is found in Solanum lycopersicum. Annotated by 3 databases (miRBase, RefSeq, ENA). Described in 4 papers. Solanum lycopersicum miR5300 stem-loop (sly-MIR5300) sequence is a product of MIR5300 precurso, MIR5300 precursor, sly-MIR5300 precursor, MIR5300 genes. Found in the tomato reference genome.
This sequence is found in {{ locations.length }} genome
| Go to location | Chromosome | Start | End | Strand | Ensembl | UCSC | Sequence identity | |
|---|---|---|---|---|---|---|---|---|
| Loading genome locations... | ||||||||
| Failed to load data from server | ||||||||
| No genome locations known | ||||||||
|
loading browser
|
{{ location.chromosome }} | {{ location.start | number }} | {{ location.end | number }} | {{ location.strand == "1" ? "forward" : "reverse" }} | {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} | UCSC | 100% | {{ location.identity * 100 | number:0 }}% |
No genome locations found for this sequence. Learn more →
Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset
UGACCAAAAUUCUUCUUCCCCAGUCCAGGCAUUCCAACAGUUGAUAACAUCUAGAUCUGCCAAUACUUUGUAUUUUUGUUCUUCUAUUUUUCACAUGACAUCUUCAAAAUCUACUAUGAGCUUCAUCAUAAGCUAAGAAAUGGUGAGUUUUGAUGAUGUGAUGCCUAAAAUAGGAUUAAAUGAAAGUACUAGUAAAAAGGUGUUCAGAUCUGGAGGUUAUGUUAAGCUGGUGGUAUGCUUUGAUUGGGAAAGAUGACUUAGGUCA
View annotations in different species by clicking on species names.
Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.