v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Chlorocebus sabaeus (African green monkey) microRNA 671 (ENSCSAG00000026301.1) secondary structure diagram

Chlorocebus sabaeus (African green monkey) microRNA 671 (ENSCSAG00000026301.1) URS000075DC96_60711

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GCAGGUGAACUGGCAGGCCAGGAAGAGGAGGAAGCCCUGGAGGGGCUGGAGGUGAUGGAUGUUUUCCUCCGGUUCUCAGGGCUCCACCUCUUUCGGGCCGUAGAGCCAGGGCUGGUGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 21 other species

  1. Cercocebus atys microRNA 671 (ENSCATG00000018639.1)
  2. Colobus angolensis palliatus miRNA (ENSCANG00000012472.1)
  3. Gorilla gorilla gorilla microRNA 671 (ENSGGOG00000031870.2)
  4. Homo sapiens microRNA hsa-mir-671 precursor
  5. Macaca fascicularis microRNA 671 (ENSMFAG00000004198.2)
  6. Macaca mulatta microRNA mml-mir-671 precursor
  7. Macaca nemestrina (Pig-tailed macaque) microRNA 671 (ENSMNEG00000016689.1)
  8. Mandrillus leucophaeus (Drill) microRNA 671 (ENSMLEG00000009365.1)
  9. Nomascus leucogenys (Northern white-cheeked gibbon) microRNA 671 (ENSNLEG00000023283.2)
  10. Pan paniscus (bonobo) microRNA 671 (ENSPPAG00000018794.1)
  11. Pan troglodytes ptr-mir-671 (ENSPTRG00000031667.2, ENSPTRG00000048585.1)
  12. Papio anubis microRNA 671 (ENSPANG00000011544.3)
  13. Piliocolobus tephrosceles (Ugandan red Colobus) miRNA (ENSPTEG00000039295.1)
  14. Pongo abelii microRNA 671 (ENSPPYG00000021737.2)
  15. Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-671 precursor
  16. Rhinopithecus bieti microRNA 671 (ENSRBIG00000016711.1)
  17. Rhinopithecus roxellana microRNA 671 (ENSRROG00000026676.1)
  18. Theropithecus gelada (gelada) microRNA 671 (ENSTGEG00000005194.1)
 2D structure Publications