v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 1507 (LINC01507) URS000075DC8C_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC01507: LINC01507 is a long non-coding RNA (lncRNA) that has been studied in the context of high-risk and low-risk patients. In high-risk patients, the expression of LINC01507 was found to be downregulated, while in low-risk patients, its expression was upregulated [PMC9662042]. LINC01507, along with six other autophagy-related lncRNAs (AL021707.6, HOTAIRM1, AC084876.1, AC010973.2, AC016773.1, and AC026401.3), was selected based on its performance in multivariate Cox regression analysis to construct a prognostic signature [PMC9662042]. In renal cell carcinoma (RCC) tissues, the expression of LINC01507 was significantly decreased [PMC9662042]. The molecular mechanism and prognostic value of LINC01507 are still not well understood [PMC7724112]. In a study on prognostic-related lncRNAs in RCC patients, it was found that high expression levels of LINC01507 were associated with more alive cases in the low-risk group [PMC7724112]. Additionally, LINC01507 was among the 81 differentially expressed prognostic-related lncRNAs identified through univariate Cox analysis [PMC9334800]. Overall, these findings suggest that LINC01507 may play a role in risk stratification and prognosis prediction in certain diseases such as RCC. However, further research is needed to fully understand its molecular mechanism and clinical significance. References: - [PMC9662042]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC9662042/ - [PMC7724112]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7724112/ - [PMC9334800]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC9334800/

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AGAAACUGCCUGUUCAAGAAAUCUGGAAGUGCAGGAAGCAGAGGGAAUCUUGGGCAGCCUCAUAGUAAUUUUCGAUAGUAUACUGGGACUUGCAAGUCCUGUCCCAGCUACUGCUGGAGAAGAGUGGCUUCUCUUUCUCUUCCCCUUCCAAAUCCUGGUGAGAUCCCUUCCUUUGAAGCGUCUGACCUGGAAUCCUAGUGAGACUAAAUUAUGAGUUCCAAUUCUGGGUAGGGCUUUCAAAAUAGAGCCCUGACCAGUGCUGAAUCAACUUGAAGAAUGAUGAAGGGUUGGCUUCUCUCUCUCAGCAGCUGUGAGUUUGGUCAGCCCUUUGCAAAGUAAGAGGAAAUUUAAUGAACCUAAAUAAGACAUGAUCCUUUGUGGCUAUAAAAGUUACACUUUGAAAAAAGCUCAGCUGGUCAAGAGCCACUUGAAAAUGAUGUUACUGCAGGGGAACUCUGUCAAAAGUCUACUCCUCUUGAUUUCCUCCUAGGCACUUUUGUCUGAACCACGUGGCACAAAUUGGCAGAGAACAAGGAAAAGAAGAACAGAGGAAGGAGAAAAGGAGAAAAGUCAUUCUGCUGAAAACGAGCUGACUGAGUUGGCUUGGCUGUACAUAGGAGGAAGACCCUGAUCCCUGGUGCUCAACACAGAAAUGCUUCAAUGAUACCCUGAGAUUGUUUUACCUUGCAACACUCUCUGGAAAAUUGCUGCUCCAGGAAUGCGAUGAAAAGAUCUGUAAGAGAGCACAGCCCCUGUUGAUUGACUUGUCUUGAUCAAACCAGAGCUUCUGGCUGGGAUACUGGUAUCUUGAGUGAGUCACAGCAGGAGAUACGUGCUGGAGCUGAAGAGGUUGGAGAGGCAGCAGAAAAGGUAGGAGACAGCAAGAGAAGGAGAGCAGCCUACAGAUGAGAAGACAAGUAAUUUACCCUAAAGUUCUAGGACUGCUGUUGGUCAAAGGAAAAAUCCUUCUGAGAGAUUUUGAUUUUAGGUUUUGAUUCUACUUCUGUUUCUAUGAAUGCUAGAGAGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications