Homo sapiens (human) URB1 antisense RNA 1 (head to head) (URB1-AS1)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) URB1 antisense RNA 1 (head to head) (URB1-AS1) URS000075DC51_9606

828 nucleotides
5 databases (GeneCards, HGNC, LncBook, LNCipedia, RefSeq)
Found in 0 other species
12 publications
1. lncRNA
2. antisense lncRNA

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

URB1-AS1: URB1-AS1 is a long non-coding RNA (lncRNA) that has been identified as a potential biomarker for the prognosis of kidney renal clear cell carcinoma (KIRC) [PMC9468637]. It is one of the 19 lncRNAs, along with LOC606724, SCART1, SNORA8, LOC728024, HAVCR1P1, FCGR1CP, LINC00240, LINC00894, GK3P, SNHG3, KIAA0125, ZNF542P, TINCR, LINC00926, PDXDC2P, COL18A1-AS1, LINC00202-1, and LINC00937, that have been identified as potential biomarkers for KIRC prognosis [PMC9468637]. Higher expression levels of URB1-AS1 have been associated with shorter survival in patients with KIRC [PMC7993680]. URB1-AS1 has also been included in a prognostic model for bladder urothelial carcinoma (BLCA) prognosis along with other lncRNAs such as LOC105375787 and CYTOR [PMC7993680].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

AGGGGCGGGGCGAUAGGGAUCCAGAGUCUUGGGGAUCCAGAGUCUUGGGGCUCCAUGUGAGUUUGCUGUACCGGUUGUCCCGGUCACGGCAUGGGGCGAGCGGACACUCCACGACACCCCCCGCCCCCGGCUGCAGGGUUUGGGGUCCACCGGGGCGCAUUUCUGAUCCCAGUGGCUCUUCGGGUGCUCUUGGCCGGAAGAACUCCCAGACCUUUCACUCCUGGCCUGGCCGAUCCACGAAGACUCGGGCCCCGGCGCGUCCAAGCAGCACAAUGAGUAGUUCUUGACCCGAGGUCGCCCUGAAGGUGUCGCAUGAAGAGCUUGCUUCACACACAACAGGAUUCGAUACUUUGCCAAUUCAAGGCCCUGGUGGCUGGCCGGGAAGGUGGAUUCGCCUUGGCUAGGUGCCAGGCAGGUCCGCCUGUGCGGGUGCCCCUGACUUCGACCCCUAGCUUAUGUCACAGCCCGAACCAGAUCGACUGGUCUGGUAGCAGCCUGUCACUCCAGACUGUCCUCCACCCCAGACUUCCGCAAACUGAUGGGCUCUUUGCGCCGUGCAGGGUGGGAGGAGAAGACCAAACGAAGUAACGUCUGUAAAACCCCUUCCUGGACAGCGUAAGGCCUCCACAUCUAAGUUCCUGUCAUUAAAAUGGAGACAGCAAAGCCGACCCUAUCCAGUCCUUGGGACUGUUAUGAACAGAAAAUGAUGCAAUGUAUGAAAAACUGCUUUGAGGAGAAAAACAACACAGUGUGUUUUUGGAAGAUGUGAUUGAUUUGUAAACCGCAUUAAAUGCUCUGAAAUAAAAUGAAAGUAAAAAUAAGUAAAAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications