Automated summary: This pre miRNA sequence is 81 nucleotides long and is found in Danio rerio. Annotated by 4 databases (Ensembl, RefSeq, miRBase, ENA). Has a conserved secondary structure or a structured region. Danio rerio (zebrafish) microRNA dre-mir-301b precursor sequence is a product of mir-301b precursor, mir-301b precurso, ENSDARG00000082169.2, mir-301b, mir301b, dre-mir-301b precursor genes. Found in the zebrafish reference genome.
This sequence is found in {{ locations.length }} genome
| Go to location | Chromosome | Start | End | Strand | Ensembl | UCSC | Sequence identity | |
|---|---|---|---|---|---|---|---|---|
| Loading genome locations... | ||||||||
| Failed to load data from server | ||||||||
| No genome locations known | ||||||||
|
loading browser
|
{{ location.chromosome }} | {{ location.start | number }} | {{ location.end | number }} | {{ location.strand == "1" ? "forward" : "reverse" }} | {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} | UCSC | 100% | {{ location.identity * 100 | number:0 }}% |
No genome locations found for this sequence. Learn more →
Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset
AAGGUCUGUUGCUUUGACGAUGUUGCACUACUGAACCAUCUAAUCAAGCAGUGCAAUAGUAUUGUCAUUGCAUUCGGCUUU
View annotations in different species by clicking on species names.
Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.