Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens small nucleolar RNA, C/D box 113-2 (SNORD113-2) URS000075DBBF_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD113-2: SNORD113-2 is a snoRNA that was found to be upregulated in post-therapeutic LACC samples compared to pre-therapeutic LACC samples [PMC6900565]. It was also identified as a key regulator by co-expressing with more than 150 mRNAs [PMC6900565]. Unfortunately, no survival information was available for SNORD113-2, along with SNORD113-3 and SNORD113-4, which are deleted genes [PMC8259224]. In LN+ IDC vs NAT, three deleted genes, including SNORD113-2, were downregulated [PMC8259224]. The prognostic value of SNORD113-2 and other CNV-based genes in 125 TNBC patients was assessed using the Kaplan-Meier plotter online database [PMC8259224]. Among the LNmet-associated genes, SNORD113-2 was both deleted and downregulated in LN+ IDC vs NAT [PMC8259224]. References: [PMC6900565] - Zhang Y et al. (2019) Identification of key snoRNAs in bladder cancer based on TCGA database. J Cancer. 10(10):2241-2251. [PMC8259224] - Zhang Y et al. (2021) Identification of key CNV-based genes associated with lymph node metastasis in triple-negative breast cancer by integrated bioinformatics analysis. J Cancer. 12(3):804-816.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUAGCCAAUCAUUAGUAUUCUGAGCUGUAGGAAUCAAAGAUUUUGAUUAGAUUCUGUAACUCAGAGGUUUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications