v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) GAS6 divergent transcript (GAS6-DT) URS000075DB95_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

GAS6-DT: GAS6-DT is a long non-coding RNA (lncRNA) that has not been extensively studied yet [PMC9270023]. However, previous research has shown that GAS6-DT, along with TMPO-AS1, can interact with other coding/non-coding RNAs and may be risk factors for lung adenocarcinoma (LUAD) [PMC9589892]. In particular, GAS6-DT was found to be significantly higher in the A549 and H1299 cell lines compared to the BEAS-2B cell line, while TMPO-AS1 was significantly higher in the H1299 cell line [PMC9589892]. High expression of GAS6-DT and TMPO-AS1 has been associated with a poorer prognosis in LUAD [PMC9589892]. In liver cancer cells with incomplete radiofrequency ablation, GAS6-DT expression is often up-regulated and can competitively inhibit the binding of microRNA-3619-5p to ARL2, promoting liver cancer cell proliferation and migration [PMC9589892]. Additionally, GAS6-DT is one of the 81 differentially expressed prognostic-related lncRNAs identified through univariate Cox analysis in LUAD [PMC9334800]. While the expression and function of GAS6-DT in neurons and the brain are not well understood, there is evidence that it is involved in upregulating GAS6 gene expression in melanomas [PMC8712770]. Overall, these findings suggest that GAS6-DT may play a role in LUAD prognosis and potentially influence neuron development and maturation.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AGCGUCCGGGACGCGGCGGGACUCGAGUGUUUCGGAAAAGGAGCGUCUCCCCAGGCGGUGGUUGUCUUCACUAGCGAUGGGGUAAAAGGAGGACGCAAUACCUGGUUCAACUUGAGCAGACGGAGUCUCGCUAUGUUGCCCAGGCUGGGGUGCAGUGGCGUGAUCUCUGCUCACUGCAAGCUCCGCCUCCCGGGUUCACGCCAUUCUCCUGCCUCAGCCUCCCGAGUAGCUGGGACCACAGGCGCCCGCCACCACGCCCGGCUGAUUUUUUUUAUUUUUAGUAGAGACGGGGUUUCACCGUGUUAGCCAGGAUGAUCUCAAUCUCCUGACCUCGUGAUCCGCCCGCCUGGGCCUCCCAAAGUGCUGGGAUUACAGGUGUGAGCCACCGCGCCUGGCCGAGCAUGUUAAUUUAAGCAAAUGAAUGUCCCUGGGAAUGAUCUUCAAGGAGAAUUAAAGUGGGAUAGAGAAGUCAUCUAUCUGCACCUGUGUCUGAACCAGAAUGACGAGGCACUUCCAUGUCAGCUAGUUACUGGAGCAGGCGGAGUAAGGAGUACCCCUGGGCUUCUGCCCCGAAACCACCACGGCUACUUCAAAACAAUAUUACAUUAAUUUUCCUGCUUGUUCUUGAGAAGCACUGGUUUGAAAAAUUGGAUGGGGUGAUACAUGUUUUAAUCAGUAUUUACAAGGCUCCUUAAUCACUUCAUCAGACAAUUCAUUGAGCACCUACUAUGUGCCAGGCAGUGUAAUUCAUUGAGCACCUGCUGUGUGCCAGGCAGUGUCUGAGGCACUUCUAGCUAUUAUUUCCUAAGGGUUCCAGCAGCCCAUGGAUAAACUUCAAAGAGUGUAAGCUCCUAAAAAUUGUUCGUAUUUUCUGCACAUUUUUGUAGUUUUGGAGAAGAGAGUUAAUGGAGUUCUUGCCAUUCUCAGAAUUAUUUGAUCCCUUUAGGAAUGAGCAUCUCUAGCCUCUGCCUGUUCAUCUGGGACAAUCUGCACCUGGGCGUGGACCUGCUGCUUCAGAUCAGUAGGUAUCAGAAUGAACUCAGUUGGAUGGGGCAGUUCAGGACCCCUGGCCUCCUUUUAGUCUGGACCCCACUCUCAUUCCUCAUAUUCUCAAUUCACUCUUUCUACUGAGUUACUAUCCUAGUAAUGACAAUGCCUCCUAUCAUCUAGAGACUUGGUUUGAUACAAUGCAUUCACAUACAACUGCUCGUUUUGAUUUCUAUAACUGGGGAAUACAGAAAGCAAAUAUGCGGUGCAAUGGAGGAUGUCUCCAUUACCCCAGAUAACUCCAAAAUUCUUCACCUAGUUACCAGUGCAGGAAAUUCGUUCGAAGGCAGAAAUGGAAAAUGAAUAAGAAACAAUUUGGAUGUGUUCCAAAAAUGGAGAGUUGUCAGGCACUAUAUCAUACAACCUGAAAUAUCAAUGGUGAAGUAGACAGUUCACCUCCACAGGGGGCAGGAGGUUGGACCCAGGGCAAUGGAUGUUUUAUAUGGAUGGUUAACCGGUCUGUGGCCAUGAGGUGGAAAGCUGUGUACACCUGUGAAGCCAUCAUCACAAUCAAGUUAGGGAACAUAUCCAUCACCCAAAAAAGUGUUCUCAUGCCCUUUGGUAAUUCCUCCCUCCUAAAUGUCCCCACCCUACCCCACAUCCCAGUUUCUAUGCAAAAACCGCUGACCAACUUUCUAUCACUAUAGAUUUGUUUGUAUUUUCUAGACUUUUAUAUAAAAAGAAUUAUACUGUAUGUACACUUUUUUGUCUGUUUUUUUCACUUAACAUAUUUAUUUUCAGAAUCAUCUAUCUUGUUGCAGGUGUAUUCCUUUUUAUUGCUCAGUAGUAUUCCACUGUAUGGAUAUAACACAAUUUGUUUAUCAUUCACCUGUUGAGGGACAUUAUACUUGCUUCUAAAUUUUUACUAUCACAAAUAAAGCUGCUGUAGGCAUUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications