Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-133b precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-133b precursor URS000075DAC1_9606

  • 119 nucleotides
  • 8 databases (ENA, Ensembl, Ensembl/GENCODE, GeneCards, HGNC, MalaCards, miRBase, RefSeq)
  • Found in 16 species

Automated summary: This pre miRNA sequence is 119 nucleotides long and is found in Homo sapiens. Annotated by 8 databases (MalaCards, Ensembl, RefSeq, miRBase, HGNC, Ensembl/GENCODE, GeneCards, ENA). Described in 46 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-133, RF00446). Homo sapiens (human) microRNA hsa-mir-133b precursor sequence is a product of mir-133b precurso, mir-133b precursor, MIR133B, mir-133b, hsa-mir-133b precursor genes. Found in the human reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    CCUCAGAAGAAAGAUGCCCCCUGCUCUGGCUGGUCAAACGGAACCAAGUCCGUCUUCCUGAGAGGUUUGGUCCCCUUCAACCAGCUACAGCAGGGCUGGCAAUGCCCAGUCCUUGGAGA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 15 other species

    1. Cercocebus atys (Sooty mangabey) miRNA
    2. Chlorocebus sabaeus (African green monkey) miRNA
    3. Colobus angolensis palliatus miRNA
    4. Gorilla gorilla gorilla (Western Lowland Gorilla) microRNA 133b
    5. Macaca fascicularis miRNA
    6. Macaca mulatta mml-mir-133b
    7. Macaca nemestrina miRNA
    8. Mandrillus leucophaeus (Drill) miRNA
    9. Nomascus leucogenys (Northern white-cheeked gibbon) miRNA
    10. Pan paniscus (bonobo) miRNA
    11. Pan troglodytes (chimpanzee) ptr-mir-133b
    12. Papio anubis (Olive baboon) miRNA
    13. Piliocolobus tephrosceles (Ugandan red Colobus) miRNA
    14. Rhinopithecus bieti miRNA
    15. Rhinopithecus roxellana miRNA
    16. Theropithecus gelada microRNA 133b
    2D structure New