Salmo salar (Atlantic salmon) ssa-miR-146a-5p

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Salmo salar (Atlantic salmon) ssa-miR-146a-5p URS000075DA96_8030

23 nucleotides
1 database (miRBase)
Found in 11 other species
7 publications

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

UGAGAACUGAAUUCCAUAGAUGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 11 other species

Cyprinus carpio (common carp) ccr-miR-146a
Danio rerio dre-miR-146a
Gadus morhua gmo-miR-146-5p
Ictalurus punctatus (channel catfish) ipu-miR-146a
Latimeria chalumnae Lch-Mir-146-P1_5p (mature (guide))
Lepisosteus oculatus (spotted gar) Loc-Mir-146-P1_5p (mature (guide))
Maylandia zebra (zebra mbuna) mze-miR-146
Monopterus albus (swamp eel) Mal-Mir-146-P1_5p (mature (guide))
Pundamilia nyererei pny-miR-146
Tetraodon nigroviridis Tni-Mir-146-P1_5p (mature (guide))
Tor tambroides miR-146a

Publications