Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Cyprinus carpio (common carp) ccr-miR-146a URS000075DA96_7962

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ccr-mir-146a: Ccr-mir-146a is a microRNA that has been studied in various organisms, including Trachinotus ovatus, Cyprinus carpio, and Epinephelus coioides [PMC8375321]. In the common carp (Cyprinus carpio), ccr-mir-146a is one of the miRNAs that regulate gonad development and is up-regulated in the juvenile ovary gonad [PMC6636164]. It has also been found to be one of the most abundant miRNAs in both common carp liver samples [PMC4849022]. In a study involving common carp fed with a high-carbohydrate diet and administered with Momordica charantia saponin, ccr-mir-146a was among the differentially expressed miRNAs that played a role in regulating the insulin signal transduction pathway and carbohydrate metabolism [PMC10113649]. Additionally, ccr-mir-146a was predicted to target Gsdf and showed increased expression from the neurula stage to primordial gonads, peaking in primordial gonads and juvenile ovaries before decreasing in adult ovaries [PMC5410099]. These findings suggest that ccr-mir-146a is involved in various biological processes, including gonad development and insulin signaling. Further research is needed to fully understand its specific functions and mechanisms of action.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGAGAACUGAAUUCCAUAGAUGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 11 other species

  1. Danio rerio dre-miR-146a
  2. Gadus morhua gmo-miR-146-5p
  3. Ictalurus punctatus (channel catfish) ipu-miR-146a
  4. Latimeria chalumnae Lch-Mir-146-P1_5p (mature (guide))
  5. Lepisosteus oculatus (spotted gar) Loc-Mir-146-P1_5p (mature (guide))
  6. Maylandia zebra (zebra mbuna) mze-miR-146
  7. Monopterus albus (swamp eel) Mal-Mir-146-P1_5p (mature (guide))
  8. Pundamilia nyererei pny-miR-146
  9. Salmo salar ssa-miR-146a-5p
  10. Tetraodon nigroviridis Tni-Mir-146-P1_5p (mature (guide))
  11. Tor tambroides miR-146a
Publications