Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Salmo salar (Atlantic salmon) ssa-miR-146a-5p URS000075DA96_8030

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGAGAACUGAAUUCCAUAGAUGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 11 other species

  1. Cyprinus carpio (common carp) ccr-miR-146a
  2. Danio rerio dre-miR-146a
  3. Gadus morhua gmo-miR-146-5p
  4. Ictalurus punctatus ipu-miR-146a
  5. Latimeria chalumnae Lch-Mir-146-P1_5p (mature (guide))
  6. Lepisosteus oculatus (spotted gar) Loc-Mir-146-P1_5p (mature (guide))
  7. Maylandia zebra mze-miR-146
  8. Monopterus albus (swamp eel) Mal-Mir-146-P1_5p (mature (guide))
  9. Pundamilia nyererei pny-miR-146
  10. Tetraodon nigroviridis (spotted green pufferfish) Tni-Mir-146-P1_5p (mature (guide))
  11. Tor tambroides miR-146a
Publications