Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Danio rerio (zebrafish) dre-miR-146a URS000075DA96_7955

Automated summary: This miRNA sequence is 23 nucleotides long and is found in Danio rerio. Annotated by 4 databases (ENA, miRBase, RefSeq, MirGeneDB). Described in 18 papers. Danio rerio (zebrafish) dre-miR-146a sequence is a product of miR-146a, mir146a, miR-146, dre-miR-146a genes. Found in the zebrafish reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UGAGAACUGAAUUCCAUAGAUGG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 53 other species

    1. Cyprinus carpio ccr-miR-146a
    2. Gadus morhua (Atlantic cod) gmo-miR-146-5p
    3. Ictalurus punctatus (channel catfish) ipu-miR-146a
    4. Latimeria chalumnae (coelacanth) Lch-Mir-146-P1_5p (mature (guide))
    5. Lepisosteus oculatus Loc-Mir-146-P1_5p (mature (guide))
    6. Maylandia zebra mze-miR-146
    7. Monopterus albus Mal-Mir-146-P1_5p (mature (guide))
    8. Pundamilia nyererei pny-miR-146
    9. Salmo salar (Atlantic salmon) ssa-miR-146a-5p
    10. Tetraodon nigroviridis Tni-Mir-146-P1_5p (mature (guide))
    11. Tor tambroides miR-146a
    Publications New