Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) GPC5 antisense RNA 1 (GPC5-AS1) URS000075DA3D_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

GPC5-AS1: GPC5-AS1, a long non-coding RNA (lncRNA), has been implicated in metastatic melanoma and identified as one of the six differentially expressed lncRNAs correlated with reduced survival time in patients with metastatic melanoma [PMC6487673]. Silencing GPC5-AS1 with shRNA in BGC-823 cells resulted in a reduction of GPC5-AS1 expression, which was found to contribute to the tumorigenicity of these cells [PMC8908922]. These findings suggest that GPC5-AS1 may play a role in the progression and prognosis of metastatic melanoma, potentially serving as a prognostic marker. Further research is needed to understand the exact mechanisms by which GPC5-AS1 influences tumor progression and survival outcomes in patients with metastatic melanoma. References: [PMC6487673] Liu, Y., Sun, J., Zhao, M., Ouyang, H., Yang, J., & Zhao, M. (2019). Identification of key lncRNAs correlated with reduced survival time in patients with metastatic melanoma based on RNA-seq data analysis. Cancer management and research, 11, 2019–2032. [PMC8908922] Liu Y., Sun J., Yang J., & Zhao M. (2020). Silencing long non-coding RNA GPC5‑AS1 inhibits tumorigenicity of BGC‑823 cells by downregulating miR‑513a‑3p expression levels. Molecular Medicine Reports, 23(5), 1-10.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUGGUUUGCAAAAAACUUCUUUUCUGAGCACUUCAACAAAGGUUGCCGUGAACAGUGACUGUCUGACAGCAAGGGAUCCUGGUCGCCUAAGGAGAAGACACAGGAGUAAUGAGAAGACACAGGAGGUAGAGCAGCACUUGCUGACUCAGAAGCAUUAACAUGAAACGCUGGAGUGCAGGGCACAAUAAUGGUUGACUGCAGCCUCAACCUCCAGGGCUCAAGGGAUCCUUCCACCUCAGCCUCCCCAGUAGUUGGGAUUACACAGAUAUUUCAAGAUUCAGCAUCAUUUCAGACCCUGAAAAAUCCCUGAAAAUUGAAUUCUCAAUAGAUAAUGCAACUCCACAUAAUAUCUGGAUUUUGUAAAUGCUUGCUAAUAAAUUAUUUUACAACGUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications