Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-300 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-300 precursor URS000075D97A_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR300: MIR300 is an intergenic miRNA belonging to the DLK1-DIO3 genomic region located on human chromosome 14 (14q32) [PMC8151247]. It has been found to play a role in chronic myelogenous leukemia (CML) stemness and the persistence of drug-resistant quiescent leukemic stem cells [PMC8269304] [PMC7960773]. MIR300-induced loss of cyclin D2/cyclin-dependent kinase 6 (CDK6) contributes to its antiproliferative activity in CML stemness [PMC8269304]. Upregulation of MIR300 in malignant cells, including through extracellular vesicles transfer from bone marrow MSCs, impairs leukemic cell proliferation [PMC7960773]. MIR300 expression is maintained in CML LSCs and affects CCND2 and CDK6, leading to cell cycle arrest and quiescence [PMC8151247] [PMC7998932]. BCR-ABL1 downregulates MIR300 in CML progenitors to protect them from apoptosis and cell cycle arrest [PMC8151247] [PMC7998932]. MIR300 has been found to target BRD7, and its overexpression can antagonize the promotive effect of MIR300 on cell growth and invasion [PMC7006413]. The TUG1/miR-300/PP2A signaling pathway is important for both CML development and treatment, as modulation of MIR300 or PP2A-activating treatment can trigger LSC apoptosis [PMC8684082]. Overall, MIR300 plays a crucial role in CML stemness, quiescence, apoptosis, and proliferation through its interaction with various target genes.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGCUACUUGAAGAGAGGUAAUCCUUCACGCAUUUGCUUUACUUGCAAUGAUUAUACAAGGGCAGACUCUCUCUGGGGAGCAAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications