v20

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-548x precursor URS000075D953_9606

Automated summary: This pre miRNA sequence is 75 nucleotides long and is found in Homo sapiens. Annotated by 6 databases (GeneCards, miRBase, RefSeq, Ensembl, HGNC, ENA). Described in 7 papers. Homo sapiens (human) microRNA hsa-mir-548x precursor sequence is a product of ENSG00000265841.1, mir-548x precurso, MIR548X, hsa-mir-548x precursor, mir-548x, mir-548x precursor genes. Found in the human reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
    		•  {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset 

    AGGUUAGUGCAAAAGUAAUUGCAGUUUUUGCGUUACUUUCAAUCGUAAAAACUGCAAUUACUUUCACACCAAUCU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 10 other species

    1. Pan paniscus (bonobo) miRNA (ENSPPAG00000018865.1)
    2. Pan troglodytes miRNA (ENSPTRG00000041447.2)
     Publications New