Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) HLA complex group 25 (HCG25) URS000075D944_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

HCG25: HCG25 is a long non-coding RNA (lncRNA) that has been identified as significantly associated with good survival in patients, particularly in cancer [PMC7007783]. It is one of the genes that are currently being studied mainly in cancer [PMC9977555]. HCG25 has been found to be upregulated in liver cancer and has great diagnostic value for hepatocellular carcinoma (HCC) [PMC6120244]. It is also aberrantly expressed in HCC tissue and has a significant diagnostic value for HCC [PMC8819098][PMC6120244][PMC8819098]. HCG25 may regulate the process of HCC through its cis-regulatory role on the expression of KIFC1, a nearby target gene [PMC6120244]. Additionally, HCG25 is one of the 15 differentially expressed lncRNAs that have remarkable prognostic value for HCC patients [PMC8819098]. In pancreatic cancer, undifferentiated cell lines such as Panc1 and HCG25 have relatively low levels of miR-200c [PMC3797065]. Furthermore, Western blot analysis revealed no detectable expression of NGAL protein in poorly differentiated pancreatic cancer cell lines such as Panc1 and HCG25 [PMC2391106]. Overall, these findings highlight the potential diagnostic and prognostic value of HCG25 in various cancers.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GAGAGCCCGGAGCCGGAUCCACUCUCAGCCUCAGGAAGCAGCAGCCUCCGCUCCGCGGCGGGUGUGCUCGGCAGUCACAGACCCACUCAGGACACCUCCCGUUGCCGACGGGCUAGACCUGCCUUAAAGGGGUCCCCGUGUCUCUCCAGUCUAGAGCCUAAGUUCAAACGAGGCGUAUAGGCGAGGACAGCAGGAAGGCUCCAAGUCAAACAAACGGAUGGGAAGUGGUCUUGGGAAACCUGAAGACACUGGGAUAUUCAGAAGGCCAAGGGGAUCCAGCUUAUCCUGUUGGGCAAGGUGCUGGGAGUGAAGGCAGGUCACCUGAAUGAUACUGGUGCCAUUUCUGAAGUUGGUGAAACUCCGCAUUACAUCCUGACUCAGAGAUUCCACUGAUGAUUUCCAGGAACUACCAAAGCCACGGAUCAGCUGAGUUACCCGGGCUAAUAGCAGGAGGAAACAGUGUCAGAGAGGGAUCUGGCUGAUCUUCAACUCCACUAAGUUCUCCCCAAGGGUCUUGCUCCAUCACCCACGCUGGAGUGCAGUGGCACAAUCACAGCUCACUACAACCUCAACUUUCCUGGCUCAGUGAUUAUCCCACCUCAGCCUCCUGAGUAGCUGGGACUAACAGGCAUGUGCCAACAUGUCCCACUCAUUUUUUUUUUAUUUUUUGUAGAGAUGGGGUUUCACCAUGUUGUCCAGGCUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications