Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-935 precursor URS000075D91F_9606

  • 91 nucleotides
  • 7 databases (ENA, Ensembl, Ensembl/GENCODE, GeneCards, HGNC, miRBase, RefSeq)
  • Found in 105 species

Automated summary: This pre miRNA sequence is 91 nucleotides long and is found in Homo sapiens. Annotated by 7 databases (ENA, HGNC, Ensembl/GENCODE, miRBase, Ensembl, GeneCards, RefSeq). Described in 18 papers. Matches 1 Rfam family (mir-935, RF03944). Homo sapiens (human) microRNA hsa-mir-935 precursor sequence is a product of mir-935 precursor, ENSG00000284583.1, mir-935 precurso, MIR935, hsa-mir-935 precursor, mir-935 genes. Found in the human reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    GGCGGGGGCGCGGGCGGCAGUGGCGGGAGCGGCCCCUCGGCCAUCCUCCGUCUGCCCAGUUACCGCUUCCGCUACCGCCGCCGCUCCCGCU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 104 other species

    1. Aotus nancymaae miRNA (ENSANAG00000013074.1)
    2. Balaenoptera musculus (Blue whale) miRNA (ENSBMSG00010019010.1)
    3. Bos grunniens (domestic yak) microRNA 935 (ENSBGRG00000021860.1)
    4. Bos indicus x Bos taurus (hybrid cattle) microRNA 935 (ENSBIXG00000017404.1, ENSBIXG00005006816.1)
    5. Bos taurus (cattle) microRNA bta-mir-935 precursor
    6. Callithrix jacchus (white-tufted-ear marmoset) miRNA (ENSCJAG00000042572.1)
    7. Camelus dromedarius microRNA 935 (ENSCDRG00005002543.1)
    8. Canis lupus dingo (dingo) microRNA 935 (ENSCAFG00020018601.1)
    9. Canis lupus familiaris (dog) miRNA (ENSCAFG00000031179.1, ENSCAFG00030001364.1, ENSCAFG00040000899.1)
    10. Capra hircus microRNA 935 (ENSCHIG00000008958.1)
    11. Catagonus wagneri microRNA 935 (ENSCWAG00000017026.1)
    12. Cercocebus atys (Sooty mangabey) miRNA (ENSCATG00000008116.1)
    13. Cervus hanglu yarkandensis (Yarkand deer) miRNA (ENSCHYG00000007097.1)
    14. Chinchilla lanigera (Long-tailed chinchilla) miRNA (ENSCLAG00000020876.1)
    15. Chlorocebus sabaeus miRNA (ENSCSAG00000025404.1)
    16. Dasypus novemcinctus (nine-banded armadillo) miRNA (ENSDNOG00000028587.1)
    17. Delphinapterus leucas (beluga whale) microRNA 935 (ENSDLEG00000005553.1)
    18. Dipodomys ordii miRNA (ENSDORG00000025059.1)
    19. Equus asinus asinus (donkey) miRNA (ENSEASG00005014368.1, ENSEASG00005021620.1)
    20. Equus caballus miRNA (ENSECAG00000034578.1)
    21. Felis catus (domestic cat) miRNA (ENSFCAG00000034674.2)
    22. Heterocephalus glaber miRNA (ENSHGLG00000022262.1)
    23. Lynx canadensis microRNA 935 (ENSLCNG00005017149.1)
    24. Macaca fascicularis (Crab-eating macaque) miRNA
    25. Macaca mulatta miRNA (ENSMMUG00000039283.2)
    26. Macaca nemestrina miRNA (ENSMNEG00000027095.1)
    27. Monodon monoceros (narwhal) miRNA (ENSMMNG00015000828.1)
    28. Moschus moschiferus microRNA 935 (ENSMMSG00000019216.1)
    29. Mustela putorius furo (Domestic ferret) microRNA 935 (ENSMPUG00000022673.1)
    30. Nannospalax galili miRNA (ENSNGAG00000004579.1)
    31. Neovison vison microRNA 935 (ENSNVIG00000003075.1)
    32. Nomascus leucogenys miRNA (ENSNLEG00000023296.2)
    33. Octodon degus (Degu) miRNA (ENSODEG00000021778.1)
    34. Otolemur garnettii miRNA (ENSOGAG00000034449.1)
    35. Ovis aries (sheep) miRNA (ENSOARG00020003572.1)
    36. Panthera leo microRNA 935 (ENSPLOG00000022275.1)
    37. Panthera pardus microRNA 935 (ENSPPRG00000014734.1)
    38. Pan troglodytes (chimpanzee) ptr-mir-935 (ENSPTRG00000033629.2)
    39. Papio anubis miRNA (ENSPANG00000027436.2)
    40. Phocoena sinus (vaquita) miRNA (ENSPSNG00000015221.1)
    41. Physeter catodon microRNA 935 (ENSPCTG00005018168.1)
    42. Piliocolobus tephrosceles miRNA (ENSPTEG00000039454.1)
    43. Pongo abelii (Sumatran orangutan) miRNA
    44. Procavia capensis miRNA (ENSPCAG00000019064.1)
    45. Prolemur simus (greater bamboo lemur) miRNA (ENSPSMG00000023530.1)
    46. Propithecus coquereli miRNA (ENSPCOG00000007964.1)
    47. Rhinolophus ferrumequinum microRNA 935 (ENSRFEG00010008819.1)
    48. Rhinopithecus bieti miRNA (ENSRBIG00000008154.1)
    49. Sciurus vulgaris (Eurasian red squirrel) miRNA (ENSSVLG00005023034.1)
    50. Spermophilus dauricus miRNA (ENSSDAG00000009559.1)
    51. Theropithecus gelada microRNA 935 (ENSTGEG00000007268.1)
    52. Urocitellus parryii (Arctic ground squirrel) miRNA (ENSUPAG00010001371.1)
    53. Ursus americanus miRNA (ENSUAMG00000012529.1)
    54. Ursus thibetanus thibetanus microRNA 935 (ENSUTTG00000016862.1)
    55. Zalophus californianus (california sea lion) miRNA (ENSZCAG00015021670.1)