Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-4521 precursor URS000075D8EE_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR4521: MIR4521 is a miRNA whose validity has been questioned and is found in miRBase [PMC5340965]. It has been identified as one of the upregulated genes in early diabetic nephropathy (DN) [PMC7759603]. In a study on colorectal cancer, high levels of MIR4521 expression were associated with poor prognosis [PMC7583989]. MIR4521 is regulated by STAT3 and was found to be overexpressed in HT29-derived tumorspheres [PMC7583989]. In the context of diabetic kidney disease (DKD), MIR4521 was identified as one of the miRNAs that may regulate differentially expressed genes (DEGs) associated with DKD pathogenesis [PMC8183707]. Additionally, a study on transfection used a pre-miR-4521 sequence for transfection purposes [PMC6754377]. In summary, MIR4521 is a miRNA whose validity has been questioned and is found in miRBase. It has been implicated in early DN and colorectal cancer prognosis. It is regulated by STAT3 and may play a role in DKD pathogenesis. The pre-miR-4521 sequence has also been used for transfection purposes.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCGGCUAAGGAAGUCCUGUGCUCAGUUUUGUAGCAUCAAAACUAGGAUUUCUCUUGUUAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Pan troglodytes miRNA
Publications