Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Meleagris gallopavo (turkey) microRNA 20a (ENSMGAG00000000422.2) URS000075D8EA_9103

Automated summary: This miRNA sequence is 98 nucleotides long and is found in Meleagris gallopavo. Annotated by 1 database (Ensembl). Matches 1 Rfam family (mir-17, RF00051). Meleagris gallopavo (turkey) microRNA 20a (ENSMGAG00000000422.2) sequence is a product of ENSMGAG00000000422.2 gene. Found in the Meleagris gallopavo reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UGACAGCUCUUGUAGCACUAAAGUGCUUAUAGUGCAGGUAGUGUUCACUAAUCUACUGCAUUAUAAGCACUUAAAGUACUGCUAGCUGUAGAACUACA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 27 other species

    1. Amazona collaria (yellow-billed parrot) microRNA 20a (ENSACOG00000009371.1)
    2. Calidris pugnax (ruff) microRNA 20a (ENSCPUG00000016348.1)
    3. Calidris pygmaea (Spoon-billed sandpiper) microRNA 20a (ENSCPGG00000011130.1)
    4. Catharus ustulatus miRNA (ENSCUSG00005010957.1)
    5. Chrysolophus pictus microRNA 20a (ENSCPIG00010009474.1)
    6. Corvus moneduloides miRNA (ENSCMUG00000003962.2)
    7. Coturnix japonica (Japanese quail) microRNA 20a (ENSCJPG00005019434.1)
    8. Cyanistes caeruleus microRNA 20a (ENSCCEG00000000395.1)
    9. Cyanoderma ruficeps microRNA 20a (ENSCRFG00000011364.1)
    10. Chloebia gouldiae (Gouldian finch) microRNA 20a (ENSEGOG00005002231.1)
    11. Falco tinnunculus miRNA (ENSFTIG00000002915.1)
    12. Ficedula albicollis (Collared flycatcher) microRNA 20a (ENSFALG00000015745.2)
    13. Gallus gallus (chicken) microRNA gga-mir-20a precursor
    14. Junco hyemalis microRNA 20a (ENSJHYG00000010595.1)
    15. Lepidothrix coronata miRNA (ENSLCOG00000006345.1, ENSLCOG00000014655.1)
    16. Lonchura striata domestica microRNA 20a (ENSLSDG00000014132.1)
    17. Malurus cyaneus samueli (superb fairywren) miRNA (ENSMCSG00000012346.1)
    18. Manacus vitellinus microRNA 20a (ENSMVIG00005011777.1)
    19. Melopsittacus undulatus (budgerigar) miRNA (ENSMUNG00000012788.2)
    20. Numida meleagris microRNA 20a (ENSNMEG00000020424.1)
    21. Phasianus colchicus microRNA 20a (ENSPCLG00000013807.1)
    22. Serinus canaria microRNA 20a (ENSSCAG00000015857.1)
    23. Strigops habroptila (Kakapo) microRNA 20a (ENSSHBG00005010532.1)
    24. Taeniopygia guttata (zebra finch) microRNA 20a (ENSTGUG00000017904.2)
    25. Zonotrichia albicollis microRNA 20a (ENSZALG00000008449.1)
    26. Zosterops lateralis melanops (silver-eye) microRNA 20a (ENSZLMG00000000632.1)