Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Gallus gallus (chicken) microRNA gga-mir-20a precursor secondary structure diagram

Gallus gallus (chicken) microRNA gga-mir-20a precursor URS000075D8EA_9031

Automated summary: This pre miRNA sequence is 98 nucleotides long and is found in Gallus gallus. Annotated by 4 databases (Ensembl, ENA, RefSeq, miRBase). Described in 8 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-17, RF00051). Gallus gallus (chicken) microRNA gga-mir-20a precursor sequence is a product of MIR20A, mir-20a precursor, ENSGALG00000018250.2, mir-20a precurso, mir-20a, gga-mir-20a precursor genes. Found in the chicken reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UGACAGCUCUUGUAGCACUAAAGUGCUUAUAGUGCAGGUAGUGUUCACUAAUCUACUGCAUUAUAAGCACUUAAAGUACUGCUAGCUGUAGAACUACA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 51 other species

    1. Amazona collaria microRNA 20a (ENSACOG00000009371.1)
    2. Calidris pugnax (ruff) microRNA 20a (ENSCPUG00000016348.1)
    3. Calidris pygmaea (Spoon-billed sandpiper) microRNA 20a (ENSCPGG00000011130.1)
    4. Catharus ustulatus (Swainson's thrush) miRNA (ENSCUSG00005010957.1)
    5. Chrysolophus pictus (golden pheasant) microRNA 20a (ENSCPIG00010009474.1)
    6. Corvus moneduloides (New Caledonian crow) miRNA (ENSCMUG00000003962.1)
    7. Coturnix japonica (Japanese quail) microRNA 20a (ENSCJPG00005019434.1)
    8. Cyanistes caeruleus (blue tit) microRNA 20a (ENSCCEG00000000395.1)
    9. Cyanoderma ruficeps (rufous-capped babbler) microRNA 20a (ENSCRFG00000011364.1)
    10. Chloebia gouldiae microRNA 20a (ENSEGOG00005002231.1)
    11. Falco tinnunculus miRNA (ENSFTIG00000002915.1)
    12. Ficedula albicollis miRNA (ENSFALG00000015745.2)
    13. Junco hyemalis microRNA 20a (ENSJHYG00000010595.1)
    14. Lepidothrix coronata miRNA (ENSLCOG00000006345.1, ENSLCOG00000014655.1)
    15. Lonchura striata domestica (Bengalese finch) microRNA 20a (ENSLSDG00000014132.1)
    16. Malurus cyaneus samueli (superb fairywren) miRNA (ENSMCSG00000012346.1)
    17. Manacus vitellinus (golden-collared manakin) microRNA 20a (ENSMVIG00005011777.1)
    18. Meleagris gallopavo (turkey) miRNA (ENSMGAG00000000422.2)
    19. Melopsittacus undulatus microRNA 20a (ENSMUNG00000012788.1)
    20. Numida meleagris (helmeted guineafowl) microRNA 20a (ENSNMEG00000020424.1)
    21. Phasianus colchicus microRNA 20a (ENSPCLG00000013807.1)
    22. Serinus canaria (common canary) microRNA 20a (ENSSCAG00000015857.1)
    23. Strigops habroptila microRNA 20a (ENSSHBG00005010532.1)
    24. Taeniopygia guttata (zebra finch) microRNA 20a (ENSTGUG00000017904.2)
    25. Zonotrichia albicollis microRNA 20a (ENSZALG00000008449.1)
    26. Zosterops lateralis melanops microRNA 20a (ENSZLMG00000000632.1)
    2D structure New