Automated summary: This miRNA sequence is 98 nucleotides long and is found in Lonchura striata domestica. Annotated by 1 database (Ensembl). Matches 1 Rfam family (mir-17, RF00051). Lonchura striata domestica (Bengalese finch) microRNA 20a (ENSLSDG00000014132.1) sequence is a product of ENSLSDG00000014132.1 gene. Found in the bengalese finch reference genome.
This sequence is found in {{ locations.length }} genome
| Go to location | Chromosome | Start | End | Strand | Ensembl | UCSC | Sequence identity | |
|---|---|---|---|---|---|---|---|---|
| Loading genome locations... | ||||||||
| Failed to load data from server | ||||||||
| No genome locations known | ||||||||
|
loading browser
|
{{ location.chromosome }} | {{ location.start | number }} | {{ location.end | number }} | {{ location.strand == "1" ? "forward" : "reverse" }} | {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} | UCSC | 100% | {{ location.identity * 100 | number:0 }}% |
No genome locations found for this sequence. Learn more →
Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset
UGACAGCUCUUGUAGCACUAAAGUGCUUAUAGUGCAGGUAGUGUUCACUAAUCUACUGCAUUAUAAGCACUUAAAGUACUGCUAGCUGUAGAACUACA
View annotations in different species by clicking on species names.
Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.