Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-587 URS000075D89C_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-587: Hsa-mir-587 is a microRNA that has been identified as a potential regulator of multiple genes. It has been predicted to target six out of seven genes, including EPS15, and five out of seven genes, including TGFβR2 and SMAD4 [PMC4838358] [PMC6874787]. Hsa-mir-587 has also been found to be shared between TLR4 and NRP1, and is associated with ACE2 networks in the diagnosis of COVID-19 [PMC8722767]. It is one of the top miRNAs regulating ACE2 networks, along with hsa-miR-302c-5p, hsa-miR-27a-3p, hsa-miR-1305, hsa-miR-26b-5p [PMC9742611] [PMC7480227]. Hsa-mir-587 is not directly involved in GBM but is associated with major cancer types and diseases [PMC5260001]. It has also been identified by multiple algorithms as a regulator of ACE2 networks [PMC7367724]. Additionally, hsa-mir-587 has been predicted to target ACE2 along with other miRNAs such as hsa-miR-588 and hsa-miR5825p [PMC7700842]. In the context of T1D, it targets DKK1 along with other miRNAs such as hsa-mir941 and hsa-mir5613p. HSA-MIR587 was also found to be one of the candidate genes within the linked region for hearing loss [PMC4510537]

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUUCCAUAGGUGAUGAGUCAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

  1. Pan troglodytes ptr-miR-587
  2. Pongo pygmaeus (Bornean orangutan) ppy-miR-587
Publications