Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) MNX1 antisense RNA 1 (head to head) (MNX1-AS1) URS000075D82B_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MNX1-AS1: MNX1-AS1 is a long non-coding RNA (lncRNA) that plays a role in tumorigenesis [PMC7366902]. Silencing MNX1-AS1 leads to a reduction in the phosphorylation of Stat3, the active form of Stat3, while the expression of Stat3 remains stable [PMC7366902]. MNX1-AS1 promotes tumorigenesis by binding to TEAD4 and up-regulating BCL2 expression [PMC9605205]. These findings suggest that MNX1-AS1 may contribute to cancer development and progression by modulating the activity of Stat3 and promoting BCL2 expression. Further research is needed to fully understand the mechanisms by which MNX1-AS1 functions in tumorigenesis and its potential as a therapeutic target.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGGGACACCAACGGGGAGUGGAUACUCCGAGGCUCAACCUGGGGCCUCUGCCCGCCCUCCCCUGGGUGCGGAGCCGGACGGCGGGCACUGGCAACCCCCGGGCCCCUGGAGAGCCCCGCGGCGGCCCAAGACCCGCUCCCGAGACACGUGGGCCCCUCCGGACUUGGUUGGUCCCUGGAGCCAGCUGCGCGCGUCCUCUCCGGCCUCCUUGUCGGCGCUGGAGUGGGUCCACGUCUGCCUUGCGGAGCGCGGUGGUUCCACGCUCCUGAGCGCCCACGCUGCGCAGACCUGGCCGCUCUGCGAGGCGACGGCAGCGCACUGAAGACCGUGGUGUUUCCCAAGCCCUCCCUGCUCUCGGGCCUCCAGGGCGCAGCAGGGGAGGGUUUUGUCCCCGUGGCCAAAGCUCUGCAGGUCGAACCUUAUCUGCUAUGGGAAGGCCCCGCAUUUUCAGAUUCACGCAGGGCCCUCUGCAGACUGUUGGCAGAAAAAAGGUAGCCACCAAACACAUGCAUAAGCUGGACUUUUCCCAGAAUGCUGCAGCAGAACUACCCUCCAGAUAGACACUAGCCUGCGGGCCACAGUGCUACGUGAGUCUUGCAAAGAGGAGAUCUUUAUGGCGAGGCUGAGAGCACUGCCUGCAUGCUUUACCAGAGCCCAGCCUCCAGCCUCCACGGAAAAUGUGUUUUGGAAUCAACACUCUUUGCAAAGGCUCCACACUGCUUUCUGGUAGCAUUGGCCUGGGCGCCCAGGCACUCCUUUAGAACCCACCUGUUCCCCCCACCCACCCUAGUGGGAGGAGGAGAGGGUUACACUGACAGAUACCGGCAGCUCUGCAACCCGGGAACAACGCAGACAACAUACAACUCGACAGAGUCACAGAAGGUGGCGUCCAUCGCGCCUGGAUGGUGACUACUGCCCUGCGGGCUGCUGGGUGGGUGAAACACACAGGGAAGAAGCACAAAUACACACACAGAUGUGGCUCAGGGAAAAAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications