Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Sus scrofa (pig) microRNA ssc-mir-216 precursor (ssc-mir-216-1) URS000075D7E0_9823

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ssc-miR-216: Ssc-mir-216 is a microRNA that has been found to have competitive binding capabilities to ssc-miR-490-5p and ssc-mir-216, as well as being highly expressed in mpiPSCs [PMC6458635] [PMC4934789]. It has also been found to have differential expression in both the CK and JK groups, along with ssc-miR-381-3p and ssc-miR-33b-3p [PMC9275911]. In terms of gender differences, ssc-mir-216 has been found to be significantly different between AGA and IUGR groups in both males and females, along with other microRNAs such as miR-188-5p and miR-144 [PMC9471991]. Furthermore, it is located in the same genome loci as ssc-miR-217 on chromosome 3 [PMC4934789]. In a study on thalamus cells, ssc-mir-216 was one of the 17 microRNAs that showed differential expression after acute H-R stress relative to normoxic controls [PMC9674649]. Overall, these findings highlight the importance of ssc-mir216 in various biological processes and its potential role as a biomarker or therapeutic target.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GAUGGCUGUGAGUUGGCUUAAUCUCAGCUGGCAACUGUGAGAUGUUCAUACAAUCCCCCACAGUGGUCUCUGGGAUUAUGCUAAACAGAGCAAUUUCCUUGCCCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications