Automated summary: This pre miRNA sequence is 100 nucleotides long and is found in Saccoglossus kowalevskii. Annotated by 3 databases (ENA, RefSeq, miRBase). Saccoglossus kowalevskii microRNA sko-mir-4821 precursor sequence is a product of mir-4821 precurso, mir-4821 precursor, 4821, sko-mir-4821 precursor, mir-4821, Mir4821 genes. Found in the Saccoglossus kowalevskii reference genome.
This sequence is found in {{ locations.length }} genome
| Go to location | Chromosome | Start | End | Strand | Ensembl | UCSC | Sequence identity | |
|---|---|---|---|---|---|---|---|---|
| Loading genome locations... | ||||||||
| Failed to load data from server | ||||||||
| No genome locations known | ||||||||
|
loading browser
|
{{ location.chromosome }} | {{ location.start | number }} | {{ location.end | number }} | {{ location.strand == "1" ? "forward" : "reverse" }} | {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} | UCSC | 100% | {{ location.identity * 100 | number:0 }}% |
No genome locations found for this sequence. Learn more →
Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset
AAAAUACCUAAUGUGGUGGUUGAGUUGAUAUUAGUAGGUUACCAUGGCAACAUAUUUCUGGCACCUGCUGCUAUCAACUGAUUCACCCAUUACAUAUCAU
View annotations in different species by clicking on species names.
Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.