Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gadus morhua (Atlantic cod) Gmo-Mir-101-P1-v2_3p (mature (guide)) URS000075D737_8049

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUACAGUACUGUGAUAACUGAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 36 other species

  1. Alligator mississippiensis (American alligator) Ami-Mir-101-P2-v2_3p (mature (guide))
  2. Anolis carolinensis Aca-Mir-101-P2-v2_3p (mature (guide))
  3. Bos taurus Bta-Mir-101-P2-v2_3p (mature (guide))
  4. Callorhinchus milii Cmi-Mir-101-P1-v2_3p (mature (guide))
  5. Canis lupus familiaris Cfa-Mir-101-P2-v2_3p (mature (guide))
  6. Cavia porcellus Cpo-Mir-101-P2-v2_3p (mature (guide))
  7. Chrysemys picta bellii (western painted turtle) Cpi-Mir-101-P2-v2_3p (mature (guide))
  8. Columba livia Cli-Mir-101-P2-v2_3p (mature (guide))
  9. Danio rerio Dre-Mir-101-P1-v2_3p (mature (guide))
  10. Dasypus novemcinctus (nine-banded armadillo) Dno-Mir-101-P2-v2_3p (mature (guide))
  11. Daubentonia madagascariensis (aye-aye) dma-miR-101
  12. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-101-P2-v2_3p (mature (guide))
  13. Gallus gallus gga-miR-101-3p
  14. Gekko japonicus Gja-Mir-101-P2-v2_3p (mature (guide))
  15. Homo sapiens Hsa-Mir-101-P2-v2_3p (mature (guide))
  16. Lepisosteus oculatus (spotted gar) Loc-Mir-101-P1-v2_3p (mature (guide))
  17. Macaca mulatta Mml-Mir-101-P2-v2_3p (mature (guide))
  18. Microcaecilia unicolor Mun-Mir-101-P2-v2_3p (mature (guide))
  19. Microcebus murinus (gray mouse lemur) mmr-miR-101
  20. Monodelphis domestica Mdo-Mir-101-P2-v2_3p (mature (guide))
  21. Monopterus albus (swamp eel) Mal-Mir-101-P1-v2_3p (mature (guide))
  22. Mus musculus Mmu-Mir-101-P1-v2_3p (mature (guide))
  23. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-101
  24. Ophiophagus hannah oha-miR-101a-3p
  25. Ornithorhynchus anatinus Oan-Mir-101-P2-v2_3p (mature (guide))
  26. Oryctolagus cuniculus (rabbit) Ocu-Mir-101-P2-v2_3p (mature (guide))
  27. Otolemur garnettii (small-eared galago) oga-miR-101
  28. Papio hamadryas pha-miR-101
  29. Python bivittatus Pbv-Mir-101-P2-v2_3p (mature (guide))
  30. Rattus norvegicus (Norway rat) Rno-Mir-101-P1-v2_3p (mature (guide))
  31. Sarcophilus harrisii Sha-Mir-101-P2-v2_3p (mature (guide))
  32. Scyliorhinus torazame Sto-Mir-101-P2-v2_3p (mature (guide))
  33. Taeniopygia guttata (zebra finch) tgu-miR-101-3p
  34. Tetraodon nigroviridis Tni-Mir-101-P1-v2_3p (mature (guide))
  35. Xenopus laevis (African clawed frog) Xla-Mir-101-P2b-v2_3p (mature (guide))
  36. Xenopus tropicalis Xtr-Mir-101-P2-v2_3p (mature (guide))