Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gallus gallus (chicken) gga-miR-101-3p URS000075D737_9031

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

gga-mir-101: Gga-mir-101 is a microRNA that has been found to be up-regulated in both MG-infected DF-1 cells and MG-infected chicken embryonic lungs, where it modulates MG-triggered inflammation by targeting genes involved in inflammatory signal pathways [PMC6627052]. It is also abundantly expressed in chicken ovaries and has been shown to target genes involved in the TGF-β signaling pathway [PMC3700833]. Gga-mir-101, along with other miRNAs such as gga-miR-1a and gga-miR-499, has been predicted to target ACVR2B, a gene involved in gonadal differentiation [PMC3107184]. In the ovaries of laying chickens, gga-mir-101 is one of the most abundantly expressed miRNAs [PMC9563710]. Gga-mir-101 has also been implicated in regulating the production of pro-inflammatory cytokines IL-6 and TNF-a in response to LPS stimulation in chickens [PMC5573731]. In studies comparing fat and lean chicken lines, gga-mir-101 was found to be significantly differentially expressed [PMC4326283]. It was also shown that miR-1 targets ACVR2B directly, while network analysis predicted that ACVR2B targets gga-mir-101 along with other miRNAs such as gga-miR-1a and gga-miR499 [PMC9364561]. Overall, these findings highlight the importance of gga-mir-101 in various biological processes and its potential as a therapeutic target.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUACAGUACUGUGAUAACUGAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 36 other species

  1. Alligator mississippiensis (American alligator) Ami-Mir-101-P2-v2_3p (mature (guide))
  2. Anolis carolinensis Aca-Mir-101-P2-v2_3p (mature (guide))
  3. Bos taurus Bta-Mir-101-P2-v2_3p (mature (guide))
  4. Callorhinchus milii Cmi-Mir-101-P1-v2_3p (mature (guide))
  5. Canis lupus familiaris Cfa-Mir-101-P2-v2_3p (mature (guide))
  6. Cavia porcellus Cpo-Mir-101-P2-v2_3p (mature (guide))
  7. Chrysemys picta bellii (western painted turtle) Cpi-Mir-101-P2-v2_3p (mature (guide))
  8. Columba livia Cli-Mir-101-P2-v2_3p (mature (guide))
  9. Danio rerio Dre-Mir-101-P1-v2_3p (mature (guide))
  10. Dasypus novemcinctus (nine-banded armadillo) Dno-Mir-101-P2-v2_3p (mature (guide))
  11. Daubentonia madagascariensis (aye-aye) dma-miR-101
  12. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-101-P2-v2_3p (mature (guide))
  13. Gadus morhua Gmo-Mir-101-P1-v2_3p (mature (guide))
  14. Gekko japonicus Gja-Mir-101-P2-v2_3p (mature (guide))
  15. Homo sapiens Hsa-Mir-101-P2-v2_3p (mature (guide))
  16. Lepisosteus oculatus (spotted gar) Loc-Mir-101-P1-v2_3p (mature (guide))
  17. Macaca mulatta Mml-Mir-101-P2-v2_3p (mature (guide))
  18. Microcaecilia unicolor Mun-Mir-101-P2-v2_3p (mature (guide))
  19. Microcebus murinus (gray mouse lemur) mmr-miR-101
  20. Monodelphis domestica Mdo-Mir-101-P2-v2_3p (mature (guide))
  21. Monopterus albus (swamp eel) Mal-Mir-101-P1-v2_3p (mature (guide))
  22. Mus musculus Mmu-Mir-101-P1-v2_3p (mature (guide))
  23. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-101
  24. Ophiophagus hannah oha-miR-101a-3p
  25. Ornithorhynchus anatinus Oan-Mir-101-P2-v2_3p (mature (guide))
  26. Oryctolagus cuniculus (rabbit) Ocu-Mir-101-P2-v2_3p (mature (guide))
  27. Otolemur garnettii (small-eared galago) oga-miR-101
  28. Papio hamadryas pha-miR-101
  29. Python bivittatus Pbv-Mir-101-P2-v2_3p (mature (guide))
  30. Rattus norvegicus (Norway rat) Rno-Mir-101-P1-v2_3p (mature (guide))
  31. Sarcophilus harrisii Sha-Mir-101-P2-v2_3p (mature (guide))
  32. Scyliorhinus torazame Sto-Mir-101-P2-v2_3p (mature (guide))
  33. Taeniopygia guttata (zebra finch) tgu-miR-101-3p
  34. Tetraodon nigroviridis Tni-Mir-101-P1-v2_3p (mature (guide))
  35. Xenopus laevis (African clawed frog) Xla-Mir-101-P2b-v2_3p (mature (guide))
  36. Xenopus tropicalis Xtr-Mir-101-P2-v2_3p (mature (guide))
Publications