Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gallus gallus (chicken) gga-miR-101-3p URS000075D737_9031

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Gallus gallus. Annotated by 4 databases (ENA, MirGeneDB, miRBase, RefSeq). Gallus gallus (chicken) gga-miR-101-3p sequence is a product of miR-101-3p, MIR101-2, miR-101, MIR101-1, gga-miR-101-3p, gga-miR-101 genes. Found in the chicken reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    GUACAGUACUGUGAUAACUGAA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 36 other species

    1. Alligator mississippiensis (American alligator) Ami-Mir-101-P2-v2_3p (mature (guide))
    2. Anolis carolinensis Aca-Mir-101-P2-v2_3p (mature (guide))
    3. Bos taurus (cattle) Bta-Mir-101-P2-v2_3p (mature (guide))
    4. Callorhinchus milii (elephant shark) Cmi-Mir-101-P1-v2_3p (mature (guide))
    5. Canis lupus familiaris Cfa-Mir-101-P2-v2_3p (mature (guide))
    6. Cavia porcellus Cpo-Mir-101-P2-v2_3p (mature (guide))
    7. Chrysemys picta bellii Cpi-Mir-101-P2-v2_3p (mature (guide))
    8. Columba livia (rock pigeon) Cli-Mir-101-P2-v2_3p (mature (guide))
    9. Danio rerio Dre-Mir-101-P1-v2_3p (mature (guide))
    10. Dasypus novemcinctus Dno-Mir-101-P2-v2_3p (mature (guide))
    11. Daubentonia madagascariensis (aye-aye) dma-miR-101
    12. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-101-P2-v2_3p (mature (guide))
    13. Gadus morhua (Atlantic cod) Gmo-Mir-101-P1-v2_3p (mature (guide))
    14. Gekko japonicus Gja-Mir-101-P2-v2_3p (mature (guide))
    15. Homo sapiens (human) Hsa-Mir-101-P2-v2_3p (mature (guide))
    16. Lepisosteus oculatus (spotted gar) Loc-Mir-101-P1-v2_3p (mature (guide))
    17. Macaca mulatta Mml-Mir-101-P2-v2_3p (mature (guide))
    18. Microcaecilia unicolor Mun-Mir-101-P2-v2_3p (mature (guide))
    19. Microcebus murinus (gray mouse lemur) mmr-miR-101
    20. Monodelphis domestica (gray short-tailed opossum) Mdo-Mir-101-P2-v2_3p (mature (guide))
    21. Monopterus albus Mal-Mir-101-P1-v2_3p (mature (guide))
    22. Mus musculus Mmu-Mir-101-P1-v2_3p (mature (guide))
    23. Nomascus leucogenys nle-miR-101
    24. Ophiophagus hannah (king cobra) oha-miR-101a-3p
    25. Ornithorhynchus anatinus Oan-Mir-101-P2-v2_3p (mature (guide))
    26. Oryctolagus cuniculus (rabbit) Ocu-Mir-101-P2-v2_3p (mature (guide))
    27. Otolemur garnettii (small-eared galago) oga-miR-101
    28. Papio hamadryas (hamadryas baboon) pha-miR-101
    29. Python bivittatus Pbv-Mir-101-P2-v2_3p (mature (guide))
    30. Rattus norvegicus Rno-Mir-101-P1-v2_3p (mature (guide))
    31. Sarcophilus harrisii Sha-Mir-101-P2-v2_3p (mature (guide))
    32. Scyliorhinus torazame Sto-Mir-101-P2-v2_3p (mature (guide))
    33. Taeniopygia guttata (zebra finch) tgu-miR-101-3p
    34. Tetraodon nigroviridis (spotted green pufferfish) Tni-Mir-101-P1-v2_3p (mature (guide))
    35. Xenopus laevis Xla-Mir-101-P2b-v2_3p (mature (guide))
    36. Xenopus tropicalis Xtr-Mir-101-P2-v2_3p (mature (guide))
    Publications New