Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Lonchura striata domestica (Bengalese finch) miRNA (ENSLSDG00000006585.1, ENSLSDG00000008395.1) secondary structure diagram

Lonchura striata domestica (Bengalese finch) miRNA (ENSLSDG00000006585.1, ENSLSDG00000008395.1) URS000075D6D8_299123

Automated summary: This pre miRNA sequence is 99 nucleotides long and is found in Lonchura striata domestica. Annotated by 1 database (Ensembl). Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-221, RF00651). Lonchura striata domestica (Bengalese finch) miRNA (ENSLSDG00000006585.1, ENSLSDG00000008395.1) sequence is a product of ENSLSDG00000008395.1, ENSLSDG00000006585.1 genes. Found in the bengalese finch reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    GACUGUCCAGGUUUGGGGCAUGAACCUGGCAUACAAUGUAGAUUUCUGUGUUUGUUAAGCAACAGCUACAUUGUCUGCUGGGUUUCCAGCUGCCUGGAA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 36 other species

    1. Accipiter nisus (Eurasian sparrowhawk) microRNA 221 (ENSANIG00000006205.1)
    2. Anas platyrhynchos microRNA 221 (ENSAPLG00020000152.1)
    3. Anas platyrhynchos platyrhynchos microRNA 221 (ENSAPLG00000000250.2)
    4. Anas zonorhyncha (Eastern spot-billed duck) miRNA (ENSAZOG00000008320.1)
    5. Anser brachyrhynchus (pink-footed goose) microRNA 221 (ENSABRG00000014670.1)
    6. Anser cygnoides microRNA 221 (ENSACDG00005017492.1)
    7. Apteryx haastii miRNA (ENSAHAG00000003232.1)
    8. Apteryx owenii (little spotted kiwi) microRNA 221 (ENSAOWG00000014785.1)
    9. Apteryx rowi microRNA 221 (ENSARWG00000007512.1)
    10. Aquila chrysaetos chrysaetos (golden eagle) microRNA 221 (ENSACCG00020000833.1)
    11. Athene cunicularia microRNA 221 (ENSACUG00000013019.1)
    12. Bubo bubo miRNA (ENSBOBG00000013088.1)
    13. Buteo japonicus miRNA (ENSBJAG00000016130.1)
    14. Cairina moschata domestica miRNA (ENSCMMG00000000971.1)
    15. Catharus ustulatus miRNA (ENSCUSG00005017300.1)
    16. Chrysolophus pictus miRNA (ENSCPIG00010008178.1)
    17. Corvus moneduloides miRNA (ENSCMUG00005005696.1)
    18. Coturnix japonica microRNA 221 (ENSCJPG00005008980.1)
    19. Cyanistes caeruleus (blue tit) microRNA 221 (ENSCCEG00000017113.1)
    20. Cyanoderma ruficeps microRNA 221 (ENSCRFG00000006862.1)
    21. Dromaius novaehollandiae (emu) microRNA 221 (ENSDNVG00000006759.1)
    22. Chloebia gouldiae microRNA 221 (ENSEGOG00005006702.1)
    23. Ficedula albicollis (Collared flycatcher) microRNA 221 (ENSFALG00000016211.2)
    24. Gallus gallus (chicken) microRNA gga-mir-221 precursor
    25. Melopsittacus undulatus miRNA (ENSMUNG00015002505.1)
    26. Numida meleagris microRNA 221 (ENSNMEG00000013117.1)
    27. Otus sunia (Oriental scops-owl) miRNA (ENSOSUG00000009355.1)
    28. Parus major (Great Tit) microRNA 221 (ENSPMJG00000010804.1)
    29. Pavo cristatus microRNA 221 (ENSPSTG00000016871.1)
    30. Phasianus colchicus microRNA 221 (ENSPCLG00000007070.1)
    31. Serinus canaria (common canary) microRNA 221 (ENSSCAG00000011348.1)
    32. Strigops habroptila microRNA 221 (ENSSHBG00005010267.1)
    33. Strix occidentalis caurina miRNA (ENSSOCG00000010696.1)
    34. Taeniopygia guttata (zebra finch) microRNA 221 (ENSTGUG00000017858.2)
    35. Zosterops lateralis melanops microRNA 221 (ENSZLMG00000004271.1)
    2D structure