Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Zosterops lateralis melanops (silver-eye) microRNA 221 (ENSZLMG00000004271.1) secondary structure diagram

Zosterops lateralis melanops (silver-eye) microRNA 221 (ENSZLMG00000004271.1) URS000075D6D8_1220523

Automated summary: This pre miRNA sequence is 99 nucleotides long and is found in Zosterops lateralis melanops. Annotated by 1 database (Ensembl). Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-221, RF00651). Zosterops lateralis melanops (silver-eye) microRNA 221 (ENSZLMG00000004271.1) sequence is a product of ENSZLMG00000004271.1 gene. Found in the silver-eye reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    GACUGUCCAGGUUUGGGGCAUGAACCUGGCAUACAAUGUAGAUUUCUGUGUUUGUUAAGCAACAGCUACAUUGUCUGCUGGGUUUCCAGCUGCCUGGAA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 35 other species

    1. Accipiter nisus (Eurasian sparrowhawk) microRNA 221 (ENSANIG00000006205.1)
    2. Anas platyrhynchos microRNA 221 (ENSAPLG00020000152.1)
    3. Anas platyrhynchos platyrhynchos microRNA 221 (ENSAPLG00000000250.2)
    4. Anas zonorhyncha miRNA (ENSAZOG00000008320.1)
    5. Anser brachyrhynchus microRNA 221 (ENSABRG00000014670.1)
    6. Anser cygnoides microRNA 221 (ENSACDG00005017492.1)
    7. Apteryx haastii miRNA (ENSAHAG00000003232.1)
    8. Apteryx owenii (little spotted kiwi) microRNA 221 (ENSAOWG00000014785.1)
    9. Apteryx rowi (Okarito brown kiwi) microRNA 221 (ENSARWG00000007512.1)
    10. Aquila chrysaetos chrysaetos microRNA 221 (ENSACCG00020000833.1)
    11. Athene cunicularia (burrowing owl) microRNA 221 (ENSACUG00000013019.1)
    12. Bubo bubo (Eurasian eagle-owl) miRNA (ENSBOBG00000013088.1)
    13. Buteo japonicus (eastern buzzard) miRNA (ENSBJAG00000016130.1)
    14. Cairina moschata domestica (muscovy Duck (domestic type)) miRNA (ENSCMMG00000000971.1)
    15. Catharus ustulatus miRNA (ENSCUSG00005017300.1)
    16. Chrysolophus pictus miRNA (ENSCPIG00010008178.1)
    17. Corvus moneduloides miRNA (ENSCMUG00000015474.1)
    18. Coturnix japonica microRNA 221 (ENSCJPG00005008980.1)
    19. Cyanistes caeruleus microRNA 221 (ENSCCEG00000017113.1)
    20. Cyanoderma ruficeps microRNA 221 (ENSCRFG00000006862.1)
    21. Dromaius novaehollandiae (emu) microRNA 221 (ENSDNVG00000006759.1)
    22. Chloebia gouldiae microRNA 221 (ENSEGOG00005006702.1)
    23. Ficedula albicollis miRNA (ENSFALG00000016211.2)
    24. Gallus gallus (chicken) microRNA gga-mir-221 precursor
    25. Lonchura striata domestica miRNA (ENSLSDG00000006585.1, ENSLSDG00000008395.1)
    26. Numida meleagris microRNA 221 (ENSNMEG00000013117.1)
    27. Otus sunia miRNA (ENSOSUG00000009355.1)
    28. Parus major microRNA 221 (ENSPMJG00000010804.1)
    29. Pavo cristatus (Indian peafowl) microRNA 221 (ENSPSTG00000016871.1)
    30. Phasianus colchicus (Ring-necked pheasant) microRNA 221 (ENSPCLG00000007070.1)
    31. Serinus canaria (common canary) microRNA 221 (ENSSCAG00000011348.1)
    32. Strigops habroptila (Kakapo) microRNA 221 (ENSSHBG00005010267.1)
    33. Strix occidentalis caurina (northern spotted owl) miRNA (ENSSOCG00000010696.1)
    34. Taeniopygia guttata (zebra finch) microRNA 221 (ENSTGUG00000017858.2)
    2D structure