Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Nothoprocta perdicaria (Chilean tinamou) microRNA 181b-1 (ENSNPEG00000005356.1) URS000075D6C6_30464

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAAAGGUCACAAUCAACAUUCAUUGCUGUCGGUGGGUUUAACUAUGUGGACAAGCUCACUGAACAAUGAAUGCAACUGUGGCCCCACAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 35 other species

  1. Accipiter nisus (Eurasian sparrowhawk) microRNA 181b-1 (ENSANIG00000005319.1)
  2. Amazona collaria microRNA 181b-1 (ENSACOG00000008638.1)
  3. Anas platyrhynchos (mallard) microRNA 181b-1 (ENSAPLG00020005578.1)
  4. Anas zonorhyncha (Eastern spot-billed duck) miRNA (ENSAZOG00000014707.1)
  5. Anser cygnoides microRNA 181b-1 (ENSACDG00005003830.1)
  6. Apteryx haastii miRNA (ENSAHAG00000015804.1)
  7. Apteryx owenii (little spotted kiwi) microRNA 181b-1 (ENSAOWG00000002819.1)
  8. Apteryx rowi (Okarito brown kiwi) microRNA 181b-1 (ENSARWG00000001599.1)
  9. Aquila chrysaetos chrysaetos microRNA 181b-1 (ENSACCG00020008794.1)
  10. Athene cunicularia (burrowing owl) microRNA 181b-1 (ENSACUG00000008344.1)
  11. Bubo bubo (Eurasian eagle-owl) miRNA (ENSBOBG00000004687.1)
  12. Buteo japonicus (eastern buzzard) miRNA (ENSBJAG00000002693.1)
  13. Cairina moschata domestica (muscovy Duck (domestic type)) miRNA (ENSCMMG00000010455.1, ENSCMMG00000010484.1)
  14. Calidris pugnax microRNA 181b-1 (ENSCPUG00000001418.1)
  15. Calidris pygmaea microRNA 181b-1 (ENSCPGG00000003268.1)
  16. Camarhynchus parvulus (small tree finch) miRNA (ENSCPVG00000013025.2)
  17. Catharus ustulatus (Swainson's thrush) miRNA (ENSCUSG00005002903.1)
  18. Cyanoderma ruficeps microRNA 181b-1 (ENSCRFG00000010510.1)
  19. Dromaius novaehollandiae (emu) microRNA 181b-1 (ENSDNVG00000007732.1)
  20. Falco tinnunculus miRNA (ENSFTIG00000008763.1)
  21. Ficedula albicollis (Collared flycatcher) miRNA (ENSFALG00000015636.2)
  22. Gallus gallus microRNA gga-mir-181b precursor (gga-mir-181b-1)
  23. Geospiza fortis (medium ground-finch) microRNA 181b-1 (ENSGFOG00000006534.1)
  24. Junco hyemalis (dark-eyed junco) microRNA 181b-1 (ENSJHYG00000016609.1)
  25. Meleagris gallopavo (turkey) miRNA (ENSMGAG00000000592.2)
  26. Melopsittacus undulatus (budgerigar) miRNA (ENSMUNG00000009761.2)
  27. Numida meleagris microRNA 181b-1 (ENSNMEG00000020194.1)
  28. Otus sunia (Oriental scops-owl) miRNA (ENSOSUG00000009552.1)
  29. Pavo cristatus (Indian peafowl) microRNA 181b-1 (ENSPSTG00000001625.1, ENSPSTG00000015556.1)
  30. Phasianus colchicus microRNA 181b-1 (ENSPCLG00000007152.1)
  31. Strigops habroptila microRNA 181b-1 (ENSSHBG00005005373.1)
  32. Strix occidentalis caurina miRNA (ENSSOCG00000012498.1)
  33. Struthio camelus australis (African ostrich) microRNA 181b-1 (ENSSCUG00000009956.1)
  34. Zonotrichia albicollis miRNA (ENSZALG00000015220.1)
  35. Zosterops lateralis melanops microRNA 181b-1 (ENSZLMG00000002196.1)