Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Meleagris gallopavo (turkey) miRNA (ENSMGAG00000000592.2) URS000075D6C6_9103

Automated summary: This miRNA sequence is 89 nucleotides long and is found in Meleagris gallopavo. Annotated by 1 database (Ensembl). Meleagris gallopavo (turkey) miRNA (ENSMGAG00000000592.2) sequence is a product of ENSMGAG00000000592.2 gene. Found in the Meleagris gallopavo reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    AAAAGGUCACAAUCAACAUUCAUUGCUGUCGGUGGGUUUAACUAUGUGGACAAGCUCACUGAACAAUGAAUGCAACUGUGGCCCCACAU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 35 other species

    1. Accipiter nisus microRNA 181b-1 (ENSANIG00000005319.1)
    2. Amazona collaria (yellow-billed parrot) microRNA 181b-1 (ENSACOG00000008638.1)
    3. Anas platyrhynchos microRNA 181b-1 (ENSAPLG00020005578.1)
    4. Anas zonorhyncha miRNA (ENSAZOG00000014707.1)
    5. Anser cygnoides (swan goose) microRNA 181b-1 (ENSACDG00005003830.1)
    6. Apteryx haastii miRNA (ENSAHAG00000015804.1)
    7. Apteryx owenii (little spotted kiwi) microRNA 181b-1 (ENSAOWG00000002819.1)
    8. Apteryx rowi (Okarito brown kiwi) microRNA 181b-1 (ENSARWG00000001599.1)
    9. Aquila chrysaetos chrysaetos microRNA 181b-1 (ENSACCG00020008794.1)
    10. Athene cunicularia microRNA 181b-1 (ENSACUG00000008344.1)
    11. Bubo bubo (Eurasian eagle-owl) miRNA (ENSBOBG00000004687.1)
    12. Buteo japonicus miRNA (ENSBJAG00000002693.1)
    13. Cairina moschata domestica miRNA (ENSCMMG00000010455.1, ENSCMMG00000010484.1)
    14. Calidris pugnax (ruff) microRNA 181b-1 (ENSCPUG00000001418.1)
    15. Calidris pygmaea (Spoon-billed sandpiper) microRNA 181b-1 (ENSCPGG00000003268.1)
    16. Camarhynchus parvulus miRNA (ENSCPVG00000013025.2)
    17. Catharus ustulatus miRNA (ENSCUSG00005002903.1)
    18. Cyanoderma ruficeps microRNA 181b-1 (ENSCRFG00000010510.1)
    19. Dromaius novaehollandiae (emu) microRNA 181b-1 (ENSDNVG00000007732.1)
    20. Falco tinnunculus miRNA (ENSFTIG00000008763.1)
    21. Ficedula albicollis (Collared flycatcher) miRNA (ENSFALG00000015636.2)
    22. Gallus gallus (chicken) microRNA gga-mir-181b precursor (gga-mir-181b-1)
    23. Geospiza fortis microRNA 181b-1 (ENSGFOG00000006534.1)
    24. Junco hyemalis microRNA 181b-1 (ENSJHYG00000016609.1)
    25. Melopsittacus undulatus (budgerigar) miRNA (ENSMUNG00000009761.2)
    26. Nothoprocta perdicaria (Chilean tinamou) microRNA 181b-1 (ENSNPEG00000005356.1)
    27. Numida meleagris microRNA 181b-1 (ENSNMEG00000020194.1)
    28. Otus sunia (Oriental scops-owl) miRNA (ENSOSUG00000009552.1)
    29. Pavo cristatus microRNA 181b-1 (ENSPSTG00000001625.1, ENSPSTG00000015556.1)
    30. Phasianus colchicus microRNA 181b-1 (ENSPCLG00000007152.1)
    31. Strigops habroptila (Kakapo) microRNA 181b-1 (ENSSHBG00005005373.1)
    32. Strix occidentalis caurina miRNA (ENSSOCG00000012498.1)
    33. Struthio camelus australis (African ostrich) microRNA 181b-1 (ENSSCUG00000009956.1)
    34. Zonotrichia albicollis microRNA 181b-1 (ENSZALG00000015220.1)
    35. Zosterops lateralis melanops (silver-eye) microRNA 181b-1 (ENSZLMG00000002196.1)