Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gallus gallus (chicken) microRNA gga-mir-181b precursor (gga-mir-181b-1) URS000075D6C6_9031

Automated summary: This pre miRNA sequence is 89 nucleotides long and is found in Gallus gallus. Annotated by 4 databases (ENA, Ensembl, miRBase, RefSeq). Gallus gallus (chicken) microRNA gga-mir-181b precursor (gga-mir-181b-1) sequence is a product of mir-181b-1, gga-mir-181b-1 precursor, mir-181b-1 precurso, ENSGALG00010014849.1, MIR181B1, mir-181b-1 precursor genes. Found in the chicken reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    AAAAGGUCACAAUCAACAUUCAUUGCUGUCGGUGGGUUUAACUAUGUGGACAAGCUCACUGAACAAUGAAUGCAACUGUGGCCCCACAU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 35 other species

    1. Accipiter nisus (Eurasian sparrowhawk) microRNA 181b-1 (ENSANIG00000005319.1)
    2. Amazona collaria (yellow-billed parrot) microRNA 181b-1 (ENSACOG00000008638.1)
    3. Anas platyrhynchos microRNA 181b-1 (ENSAPLG00020005578.1)
    4. Anas zonorhyncha (Eastern spot-billed duck) miRNA (ENSAZOG00000014707.1)
    5. Anser cygnoides microRNA 181b-1 (ENSACDG00005003830.1)
    6. Apteryx haastii miRNA (ENSAHAG00000015804.1)
    7. Apteryx owenii (little spotted kiwi) microRNA 181b-1 (ENSAOWG00000002819.1)
    8. Apteryx rowi microRNA 181b-1 (ENSARWG00000001599.1)
    9. Aquila chrysaetos chrysaetos (golden eagle) microRNA 181b-1 (ENSACCG00020008794.1)
    10. Athene cunicularia microRNA 181b-1 (ENSACUG00000008344.1)
    11. Bubo bubo miRNA (ENSBOBG00000004687.1)
    12. Buteo japonicus miRNA (ENSBJAG00000002693.1)
    13. Cairina moschata domestica miRNA (ENSCMMG00000010455.1, ENSCMMG00000010484.1)
    14. Calidris pugnax (ruff) microRNA 181b-1 (ENSCPUG00000001418.1)
    15. Calidris pygmaea (Spoon-billed sandpiper) microRNA 181b-1 (ENSCPGG00000003268.1)
    16. Camarhynchus parvulus miRNA (ENSCPVG00005008173.1)
    17. Catharus ustulatus miRNA (ENSCUSG00005002903.1)
    18. Cyanoderma ruficeps microRNA 181b-1 (ENSCRFG00000010510.1)
    19. Dromaius novaehollandiae (emu) microRNA 181b-1 (ENSDNVG00000007732.1)
    20. Falco tinnunculus miRNA (ENSFTIG00000008763.1)
    21. Ficedula albicollis (Collared flycatcher) miRNA (ENSFALG00000015636.2)
    22. Geospiza fortis microRNA 181b-1 (ENSGFOG00000006534.1)
    23. Junco hyemalis microRNA 181b-1 (ENSJHYG00000016609.1)
    24. Meleagris gallopavo miRNA (ENSMGAG00000000592.2)
    25. Melopsittacus undulatus miRNA (ENSMUNG00015003660.1)
    26. Nothoprocta perdicaria (Chilean tinamou) microRNA 181b-1 (ENSNPEG00000005356.1)
    27. Numida meleagris microRNA 181b-1 (ENSNMEG00000020194.1)
    28. Otus sunia (Oriental scops-owl) miRNA (ENSOSUG00000009552.1)
    29. Pavo cristatus microRNA 181b-1 (ENSPSTG00000001625.1, ENSPSTG00000015556.1)
    30. Phasianus colchicus microRNA 181b-1 (ENSPCLG00000007152.1)
    31. Strigops habroptila microRNA 181b-1 (ENSSHBG00005005373.1)
    32. Strix occidentalis caurina miRNA (ENSSOCG00000012498.1)
    33. Struthio camelus australis microRNA 181b-1 (ENSSCUG00000009956.1)
    34. Zonotrichia albicollis microRNA 181b-1 (ENSZALG00000015220.1)
    35. Zosterops lateralis melanops microRNA 181b-1 (ENSZLMG00000002196.1)
    Publications New