Homo sapiens (human) microRNA hsa-mir-551b precursor

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-551b precursor URS000075D680_9606

96 nucleotides
7 databases (ENA, Ensembl, GeneCards, HGNC, MalaCards, miRBase, RefSeq)
Found in 0 other species
223 publications
1. transcript
2. pre-miRNA

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR551B: MIR551B is a microRNA that has been studied to determine its putative targets. Web-based tools like miRanda and Targetscan were used to predict potential targets, and it was found that the 3'-UTR of ZEB1 is a potential target of MIR551B [PMC6563032]. Additionally, it was acknowledged that MIR551B may also activate the promoters of certain target genes [PMC6563032].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

AGAUGUGCUCUCCUGGCCCAUGAAAUCAAGCGUGGGUGAGACCUGGUGCAGAACGGGAAGGCGACCCAUACUUGGUUUCAGAGGCUGUGAGAAUAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure

Publications