Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 226 (LINC00226) URS000075D64F_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC00226: LINC00226 is a long non-coding RNA (lncRNA) that has been found to be involved in various cancers [PMC8108987]. It has been identified as a preserved genomic alteration in both glioblastoma (GBM) and grade II/III primary cells, along with ADAM6 amplifications [PMC8108987]. Up-regulation of LINC00226 has been associated with poor prognosis, enhanced cell invasion, stemness, and proliferation in cancers [PMC8108987]. In pancreatic ductal adenocarcinoma (PDAC), LINC00226 is downregulated in half of the cell lines [PMC5345666]. However, there is currently no evidence regarding the expression pattern and role of LINC00226 in human cancers [PMC5345666]. In addition to PDAC, LINC00226 has also been found to be deleted or amplified in other cancer types such as germ cell tumors [PMC7599102] and infertility-related conditions [PMC7599102]. It is worth noting that LINC00226 is located in the same cytoband as other genes such as FAM30A and LINC00221 [PMC8269160]. Furthermore, amplification of LINC00226 has also been observed along with amplification of LINC00221 [PMC9150447]. Overall, these findings suggest that LINC00226 may play a role in cancer development and progression [PMC8108987].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCGGCCGCUCCGACCCGGCCUCUGGCGCUGGCUCUCCGCCCGCUGGGCAUCCGCUCCCCGCGCGGCACGUGCGGCGGCCCCUGCGCGCCUGGCUCAGCCCUGGCGCCGCUCCAUUCCGCCAGGCGCGGGCGGGCAGGAGCUCUGGAAAAAAUUAUUCUAAGAGACAAAUUAAAAGAAUAAUCUGUAAUAAGGAGACGUCAACAUUCCAUCUCAGGAAAAAACUGAAAACAUGUAAUACAUACAAAGUCCUGAGAAGAAACCUCGAAGCACAGGAAGGGUCUCAUGUAUAGUAGCAUGUUGAGAAAACUGAAGAGCCCUGUAAUCCUGAGGAGGGGGCCUAAUCCAAGGAGAGAGAGGCUCCGGGUCCUGUGGACACACACGGGUUGCCUGCUUCACCCCAUCUAGGAGCUGCUUCCUGAAGCCUUCAGGAGGCAGGAGGCUGAAUUUGUUUCUCAGGACAAUCUUAAUCACAUCCGGACAGGGAGAAAAACAUUCAUGACCUAGGACAGAUAAAAUAUGUAUAAUUAAAAUUUCAUUGAAAAUUGAGAAAUUUUGGUUGUAUGUAUUUAUAGUGAAUAAAGCUAUGUUAUGAUUUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications