Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-1299 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-1299 precursor URS000075D629_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR1299: MIR1299 is a novel non-coding RNA (ncRNA) marker that has not been previously associated with any diseases, including cancer [PMC5354851]. This study is the first to report the expression of MIR1299 in ameloblastoma tumors [PMC5354851]. In addition to MIR1299, other miRNAs such as miR1256, miR205, miR4454, and miR548X were found to be overexpressed in ameloblastoma tumors [PMC5354851]. Furthermore, MIR1299 was found to be upregulated in both ASD and Non-TD subjects, along with other genes such as IGLV1-40, LRRC37A4P, PMCHL2, and TRBV11-2 [PMC6814108]. In Non-TD subjects specifically, LRRC37AP, MIR1299 PMCHL2 and TRBV11-2 were among the top upregulated genes [PMC6814108]. Another study demonstrated the overexpression of MIR1299 in ameloblastomas using microarrays and suggested its potential role in the etiopathogenesis of this tumor [PMC7920560]. Additionally, MIR1299 was identified as one of the top genes depleted in a replicate screen along with FAM32A EIF3I BIRC2 BCL2 [PMC9402397]. Finally, based on NGS data from a previous study, MIR1299 was selected as a target for further miRNA analysis [PMC8744551]. References: - PMC5354851 - PMC6814108 - PMC7920560 - PMC9402397 - PMC8744551

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCUCAUGGCAGUGUUCUGGAAUCCUACGUGAGGGACAAUCAUUCAGACCCACGUAGCAGUGUUCUGGAAUUCUGUGUGAGGGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications