Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-369 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-369 precursor URS000075D5A7_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR369: MIR369 is a family of microRNAs that has been extensively studied in various biological processes. It is located on chromosome 8 and has been shown to enhance the expression of PKM2 through the stabilization of HNRNPA2B1 in cell reprogramming [PMC7780020]. MIR369 has also been found to inhibit the proliferation and metastasis of hepatocellular carcinoma cells by directly targeting ZEB1 [PMC8040887]. It is regulated by FUS3, a transcription factor that controls the expression of several miRNA genes, including MIR369 [PMC4162360]. In various studies, MIR369 has been identified as a hub gene in different biological contexts, such as SJS/TEN [PMC9027774]. It has also been implicated in cell reprogramming processes, where it can enhance the efficiency of reprogramming by replacing traditional nuclear factors [PMC5951134]. Additionally, MIR369 has been found to target genes involved in stomatal movement and growth-regulating factors (GRF) silence [PMC8233840] [PMC8417703]. The expression level of MIR369 can vary depending on the cell type and differentiation state. In pluripotent cells, it is highly expressed but decreases upon differentiation [PMC4503752]. The epigenetic regulation of MIR369 coding region also plays a role in its expression pattern during differentiation [PMC4503752]. Overall, these studies highlight the diverse roles and regulatory mechanisms associated with MIR369.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUGAAGGGAGAUCGACCGUGUUAUAUUCGCUUUAUUGACUUCGAAUAAUACAUGGUUGAUCUUUUCUCAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 18 other species

2D structure Publications